báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc
báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc
... tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case reportHoi Yan Lam*, Chun Kwong Lo, Kai Yin CheungAbstract Paediatric ... intra-articular pin pla cement, causing septicarthritis and a risk of damaging the growth plate. An external fixator is also used for the treatment of paediatric supracondylar fractures but there may ... System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report. Journal of Orthopaedic Surgery and Research 2010 5:10.Submit your next manuscript...
- 6
- 438
- 0
Báo cáo hóa học: " Research Article An MLP Neural Net with L1 and L2 Regularizers for Real Conditions of Deblurring" doc
... that w e manage “backward” and“forward” concepts in the opposite sense to a standard imagerestoration because of the architecture of the net.During the back-propagation process, the network ... The complexity of the net can be analyzed in the two stages which describe the algorithm: forward pass (FP) and backward pass (BP). The computation of the gradient δ(m) in the output layer makes the ... according to the default parameters. InTV1 and TV2, we have particularized them not to have priorinformation about the hyperparameters, and, therefore, the confidence parameters γαand γβhave been...
- 18
- 408
- 0
báo cáo hóa học:" Research Article A Variable Step-Size Proportionate Affine Projection Algorithm for Identification of Sparse Impulse Response" pot
... signal. The proposed VSS-SPAPA canachieve a lower steady-state misalignment than SPAPA,approximate 10 dB improvement was achieved. The steady-state misalignment of VSS-APA was the same as that of ... verydifficult to analyze the transient performance of PAPAs. Inthissection,weproposeavariablestepsizeforPAPA. The APA can be derived from the principle of leastperturbation, that is, to maintain the next ... αmax. For a modest inaccurate estimate of σ2v(t), the performance of the proposed algorithm is betterthan that of the VSS-APA because it benefits from the fastproportionate adaptive algorithms....
- 10
- 292
- 0
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... AK and SK arranged the data collec-tion, took part in the interpretation of the data, and the writing of the manuscript. AT and AE undertook the dataanalysis and interpretation, and also participated ... according to age, gender andeducation. Rasch analysis was then used to test the internal construct validity of the scale and the validity of the cut points for pass scores on the pooled data ... reasonable starting point for this analysis. The design of the normative populationsample meant that group sizes at the level of age and edu-cational group were similar. Although we used parametricANOVA...
- 8
- 448
- 0
báo cáo hóa học: " Indoors illumination and seasonal changes in mood and behavior are associated with the health-related quality of life" pdf
... with the health-related quality of lifeSharon Grimaldi*, Timo Partonen, Samuli I Saarni, Arpo Aromaa and Jouko LönnqvistAddress: National Public Health Institute, Department of Mental Health and ... or the light-dark transitions, areneeded for reset of the principal circadian clock on a dailybasis. The principal circadian clock, which is located in the suprachiasmatic nuclei of the anterior ... hypothalamusin the brain, also reacts to changes in the length of day [1]and thereby tunes the drive to its targets [2]. Changes of season challenge these time-keeping mechanisms of action as, for...
- 8
- 469
- 0
báo cáo hóa học: " Microglia use multiple mechanisms to mediate interactions with vitronectin; non-essential roles for the highly-expressed avb3 and avb5 integrins" pptx
... support the first mechanism, because loss of both of the major b subunits b3 and b5 in microglia didnot result in any compensatory upregulation of avb1oravb8; rather the total am ount of the av ... confirm changes of microglial activation at the molecular level, we alsoexamined cell surfac e expression of the activation mar-kers MHC class I, and the integrins, a4 b1, a5 b1andaMb2 (Mac-1). ... observations, demonstrating that inaddition to avb3andavb5, microglia also express lowlevels of two additional avintegrins,avb1andavb8. The microglial avb8 integrin acts as a functionalvitronectin...
- 10
- 279
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... S RNA of TULV.GGAAAUG GCCAAGUG-C A- UG-C A- UU -A G GU -A G:UC A- UU -A 337 381(+) senseU:GU -A C UC-GU -A C-GU -A C-GU -A A-UC C A- UC A GU -A A-U(-) sense A C A- UG A G-C A- UCCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt831–855). To monitor the presence of recTULV S RNA,RT-PCR was performed with primers RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) andHairpin-like ... Molecular Systems) was used. Tomonitor the presence of TULV S RNA on passages, RT-PCRwas performed with primers VF738(5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) andVR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3';...
- 5
- 430
- 0
báo cáo hóa học:" Open wedge high tibial osteotomy: cause of patellar descent" docx
... center and another point at 30% lateral to center of tibial plateau surface [8]. Next, a tracing of the portion of tibia distal to the osteotomy was made. It was then superimposed on the radiograph ... syndrome, intraoperative fracture of tibial plateau fragment or neurovascular injury. 6 plane parallel to the joint surface. Another Kirschner wire was inserted at that plane parallel to the first ... contracture was less than 10° and flexion range was greater than 90°. Radiograph of knee showed varus deformity and predominant narrowing of medial joint space while the lateral and patellofemoral...
- 22
- 237
- 0
báo cáo hóa học:" Factors influencing agreement between child self-report and parent proxy-reports on the Pediatric Quality of Life Inventory™ 4.0 (PedsQL™) generic core scales" pptx
... indicating higher QOL. The internal reliability (Cronbach's alpha coefficients) for PedsQL™ 4.0 was calculated. We assumed a minimumstandard of 0.70 for Cronbach's alpha coefficients for ... was assessed using Spear-man's correlation coefficients, for the total sample andseparately for the three age groups.ResultsInternal reliabilityCronbach's alpha coefficients for ... the analysis, drafted and revised the manuscript. CE and MBboth contributed to the design of the study; interpretation of the data and analyses; and revised the article for impor-tant intellectual...
- 8
- 365
- 0
báo cáo hóa học:" Systematic use of mother tongue as learning/teaching resources in target language instruction" potx
... from their design and rationale: 1) taking advantage of similarities between Chinese and English language systems; 2) taking advantage of differences between the two language systems proactively ... 2011. First language and target language in the foreign language classroom. Language Teaching, 44 (1): 64-77. Macaro, E. 2009. Teacher use of codeswitching in the second language classrooms: exploring ... not always mentioned, nor made overt use of under the influence of the TL-only pedagogy. The fact that any language can be used to convey any proposition, from theological parables to military...
- 29
- 364
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP