báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc

... tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report Hoi Yan Lam * , Chun Kwong Lo, Kai Yin Cheung Abstract Paediatric ... intra-articular pin pla cement, causing septic arthritis and a risk of damaging the growth plate. An external fixator is also use...

Ngày tải lên: 20/06/2014, 04:20

... that w e manage “backward” and “forward” concepts in the opposite sense to a standard image restoration because of the architecture of the net. During the back-propagation process, the network ... The complexity of the net can be analyzed in the two stages which describe the algorithm: forward pass (FP) and backward pass (BP). The computation of the gradient δ(...

Ngày tải lên: 21/06/2014, 08:20

... signal. The proposed VSS-SPAPA can achieve a lower steady-state misalignment than SPAPA, approximate 10 dB improvement was achieved. The steady- state misalignment of VSS-APA was the same as that of ... very difficult to analyze the transient performance of PAPAs. In thissection,weproposeavariablestepsizeforPAPA. The APA can be derived from the principle of least perturbat...

Ngày tải lên: 21/06/2014, 20:20

... AK and SK arranged the data collec- tion, took part in the interpretation of the data, and the writing of the manuscript. AT and AE undertook the data analysis and interpretation, and also participated ... according to age, gender and education. Rasch analysis was then used to test the internal construct validity of the scale and the validity of the cut points for...

Ngày tải lên: 20/06/2014, 15:20

... with the health-related quality of life Sharon Grimaldi*, Timo Partonen, Samuli I Saarni, Arpo Aromaa and Jouko Lönnqvist Address: National Public Health Institute, Department of Mental Health and ... or the light-dark transitions, are needed for reset of the principal circadian clock on a daily basis. The principal circadian clock, which is located in the suprachiasmatic...

Ngày tải lên: 18/06/2014, 19:20

... support the first mechanism, because loss of both of the major b subunits b3 and b5 in microglia did not result in any compensatory upregulation of avb1or avb8; rather the total am ount of the av ... confirm changes of microglial activation at the molecular level, we also examined cell surfac e expression of the activation mar- kers MHC class I, and the integrins, a...

Ngày tải lên: 19/06/2014, 22:20

... S RNA of TULV. GGAAAUG GCCAAGU G-C A- U G-C A- U U -A G G U -A G:U C A- U U -A 337 381 (+) sense U:G U -A C U C-G U -A C-G U -A C-G U -A A-U C C A- U C A G U -A A-U (-) sense A C A- U G A G-C A- U CCUUUAC ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855). To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATT...

Ngày tải lên: 20/06/2014, 04:20

... center and another point at 30% lateral to center of tibial plateau surface [8]. Next, a tracing of the portion of tibia distal to the osteotomy was made. It was then superimposed on the radiograph ... syndrome, intraoperative fracture of tibial plateau fragment or neurovascular injury. 6 plane parallel to the joint surface. Another Kirschner wire was inserted at t...

Ngày tải lên: 20/06/2014, 07:20

... indicating higher QOL. The internal reliability (Cronbach's alpha coefficients) for PedsQL™ 4.0 was calculated. We assumed a minimum standard of 0.70 for Cronbach's alpha coefficients for ... was assessed using Spear- man's correlation coefficients, for the total sample and separately for the three age groups. Results Internal reliability Cronbach's alp...

Ngày tải lên: 20/06/2014, 15:20

... from their design and rationale: 1) taking advantage of similarities between Chinese and English language systems; 2) taking advantage of differences between the two language systems proactively ... 2011. First language and target language in the foreign language classroom. Language Teaching, 44 (1): 64-77. Macaro, E. 2009. Teacher use of codeswitching in the second language...

Ngày tải lên: 21/06/2014, 17:20