báo cáo hóa học:" Long-term sequel of posterolateral rotatory instability of the elbow: a case report" ppt
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... 5'-CACCCAGCACAATGAAGAT-3'; ACTBreverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi-tions were used as described previously [17]: 95°C for 10min to activate DNA polymerase, followed ... ABCC2-dependingcisplatin resistance in NPC.ABCC2 siRNA increased the intracellular accumulation of cisplatinFigure 2ABCC2 siRNA increased the intracellular accumulation of cisplatin. (A) A ... Surowiak P, Materna V, Kaplenko I, Spaczynski M, Dolinska-Krajew-ska B, Gebarowska E, Dietel M, Zabel M, Lage H: ABCC2 (MRP2,cMOAT) Can Be Localized in the Nuclear Membrane of Ovarian Carcinomas...
- 9
- 509
- 0
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... Cancer 2005, 41:2355-9.19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N,Orita K: ICAM-1 expression and the soluble ICAM-1 level forevaluating the metastatic potential of gastric ... University of the Basque Country, Leioa, Bizkaia-48940, SpainEmail: Mar a Valcárcel - valcarcelcuesta@yahoo.es; Beatriz Arteta - tirtxe@euskalnet.net; Arrate Jaureguibeitia - ajaureguibeitia@pharmakine.com; ... Martínez1, Lorea Mendoza1, Francisco J Muruzabal1, Clarisa Salado1 and Fernando Vidal-Vanaclocha*2,3Address: 1Pharmakine Ltd., Bizkaia Technology Park, Derio, Bizkaia-48160, Spain, 2Basque...
- 12
- 419
- 0
báo cáo hóa học:" An intron 9 containing splice variant of PAX2" pptx
... GTCGTGA CATGGCGAGC ACCACTCTGC CTGGTTACCC CCCTCACG TGCCCCCCACTG GCCAGGGAAG CTACCCCACC TCCACCCTGG CAGGAATG GTIntron 9GCCTG g t a g gtgacaatgc tgcagctgcc taatctaggt ggggggaact a aattgtggg tgagctgctg ... tgagctgctg a atggtctgtagtctgaggc tggggtggggggagacacaa cgtcccctcc ctgcaaacca ctgctattct g tccctctctExon 10 c t c c t t a g AG GCTGCAGTTG GTCCCTCATC CTCCCTCATG AGCAAGCCGGGGAGGAAGCT T GCAGAAGT GCCCCCTTGT ... ggggggaact a aattgtggg tgagctgctg a atggtctgtagtctgaggc tggggtggggggagacacaa cgtcccctcc ctgcaaacca ctgctattct g tccctctctExon 10 c t c c t t a g AG GCTGCAGTTG GTCCCTCATC CTCCCTCATG AGCAAGCCGGGGAGGAAGCT...
- 6
- 413
- 0
báo cáo hóa học:" Hypoglycemic and beta cell protective effects of andrographolide analogue for diabetes treatment" pot
... mechanisms of action of this promising new anti-diabetic agent arewarranted.Abbreviations A. paniculata: Andrographis paniculata; Andro: androgra-pholide; AL-1: andrographolide-lipoic acid ... insulin in the pan-creata of the glibenclamide-treated animals despite the fact that these animals had fairly large beta cell mass (Fig.3), suggesting that the ability of these beta cells to ... http://www.translational-medicine.com/content/7/1/62Page 13 of 13(page number not for citation purposes)36. Kaneto H, Kajimoto Y, Miyagawa J, Matsuoka T, Fujitani Y, UmayaharaY, Hanafusa T, Matsuzawa Y, Yamasaki Y, Hori M: Beneficial effectsof...
- 13
- 591
- 0
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx
... andMedarex. AK and OK are employees of Merck KGaA; OK isalso an Adjunct Professor at the University of North Caro-lina at Chapel Hill, NC, USA. SDG is a former employee of Merck KGaA and an ... metastatic melanomaand renal cell carcinoma. J Immunother 2003, 26:130-138.13. Antony PA, Paulos CM, Ahmadzadeh M, Akpinarli A, Palmer DC, SatoN, Kaiser A, Hinrichs CS, Klebanoff CA, Tagaya Y, Restifo ... (IFN), had a Karnofsky performance status of ≥ 70%, and had ade-quate organ function. Patients were enrolled at least 4weeks after their last dose of prior therapy. Patients wereto have at least...
- 11
- 673
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... combination DNA and inactivated rabies virus vaccine. HumGene Ther 2001, 12:1917-1922.32. Wang S, Parker C, Taaffe J, Solórzano A, Garc a- Sastre A, Lu S: HeterologousHA DNA vaccine prime–inactivated ... elec-troporated DNA as a boost ing agent [65]. Effectivepriming may also be achievable through intr adermaldelivery of DNA as shown in a model of human skintattooing [66].In light of the scarcity of ... [18],intra-lymphatic administration [19,20], or other enhan-cing approaches such as electroporation [21], have onlypartially improved the immune re sponse achievable byDNA vaccination alone. Nevertheless,...
- 11
- 505
- 0
báo cáo hóa học: " Thai SF-36 health survey: tests of data quality, scaling assumptions, reliability and validity in healthy men and women" pdf
... Krittayaphong R, Bhuripanyo K, Raungratanaamporn O, Chotinaiwa-tarakul C, Chaowalit N, Punlee K, Kangkagate C, Chaithiraphan S:Reliability of Thai version of SF-36 questionnaire for the eval-uation ... performed the statistical analysis and drafted the manuscript. SSdesigned, managed and coordinated the study. AS partici-pated in the study conduct and manuscript preparation.All authors read and approved ... experience. Journal of the Medical Association of Thailand 2007,90:1458-1466.7. Sungkanakara C, Assanasen P, Banhiran W, Metheetrairut C:Abstracts 2nd world congress of the world association of sleep...
- 9
- 574
- 0
báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt
... Participationwas voluntary and anonymous. Ethical approval wasobtained from the institutional review board.We used the German version of the EQ-5D for which data of the general population of Germany ... available for the generalpopulation of Austria, we compared our data on self-reported health of medical students with the self-reportedhealth data of a German general population sample [11]. The ... health state on a thermometer-style VASaccording to its relative rank. The VAS was bounded by the worst imaginable health state (0) and the best imaginablehealth state (100). Participants were...
- 6
- 423
- 0
Báo cáo hóa học: " Patient-cooperative control increases active participation of individuals with SCI during robot-aided gait training" pdf
... all patients, data analysis, statistical analysis, and drafted the manuscript. RR participated in the design and coordination of the studyand assisted with drafting the manuscript. All authors ... axes of the Lokomat.Data analysisSpatiotemporal variabilityTo quantify the amount of temporal and spatial varia-tions in the gait patterns during walking in the differentFigure 1 Control algorit ... capabilities of patients,particularly of patients transitioning from a non-ambula-tory to an ambulatory state during their rehabilitationprocess. Finally, we evaluated the feasibility of the pathcontrol...
- 13
- 427
- 0
Báo cáo hóa học: " Oromotor variability in children with mild spastic cerebral palsy: a kinematic study of speech motor control" docx
... markers atper-auricular areas. The y-axis is perpendicular to the frontal plane passing through markers at the foreheadand bila teral pre-auricular areas. The z-axis is ortho go-nal to x-andy-axis. ... stoppingand voicing (2 cases), backing (one case) , fronting andde-affrication (one case) , and other error (one case) .Experimental setup of Kinematic analysisDuring the Kinematic analysis task, the ... carried out the kinematic data collection and analysis. FGYparticipated in the data interpretation and the revising of this manuscript.LYY carried out the data collection and analysis. CYW carried...
- 10
- 421
- 0
Từ khóa: báo cáo hóa họctài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfhoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP