báo cáo hóa học:" RNAi dependent epigenetic marks on a geminivirus promoter" doc

... amplifica- tion the left arm (KpnI F: GGTACCAATCTCAACTAGA- GACACTCTTGA) and (ClaI R: ATCGATGCACAAATATTTAATTGCCAG), and the right arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC) and (BamHI R: GGATCCAATGAGTTGATCTCTGTGA- GAACT). ... analysed by electrophoresis on a 2% agarose gel. The primer pairs used were ACMV DNA A F: CTCAACTAGAGACACTCTTGA and R: CACAAATATT- TAATTGCCAG, Tnt-retroposon (GenBa...

Ngày tải lên: 20/06/2014, 04:20

... F: CTCAACTAGAGACACTCTTGA and R: CACAAATATT- TAATTGCCAG, Tnt-retroposon (GenBank: X13777 ) F: CATTGGTTCTAAAGGATGTGCGGC and R: GAAATCT- CATCTTGTGCCGCGTTC. Results and conclusion A transgene consisting ... or Small RNA-directed DNA and histone methylationFigure 2 Small RNA-directed DNA and histone methylation. (A) Schematic representation of Sau96 I restriction sites in ACMV DNA A promoter...

Ngày tải lên: 19/06/2014, 08:20

... 57:43-66. 52. Chauhan SC, Singh AP, Ruiz F, Johansson SL, Jain M, Smith LM, Moni- aux N, Batra SK: Aberrant expression of MUC4 in ovarian car- cinoma: diagnostic significance alone and in combination with ... Associated Glycoprotein-72 (TAG-72) in ovarian cancer and its association with disease stage may serve as a potential marker for effective disease management [56]. In addition, surface...

Ngày tải lên: 20/06/2014, 07:20

... of nano- components. Among these approaches, the so- called bot- tom-up method is attracting increasing attention. Based on this method, the self-organization of gold nanoparticles on a planar ... patternable templates for in-situ nanofabrication of metal-semiconductor-organic surface structures -a generic approach. Adv Mater 2000, 12:725-731. 3. Kondo Y, Takayanagi K: Synthesis and ch...

Ngày tải lên: 20/06/2014, 22:20

... surface of Si like a thin film. As a result, LRA stage gradually tran- sits to SLA stage. The second stage, SLA, is characterized by formation of nanocones on the irradiated surface of a semiconductor by ... of height, leading to gradual change of bandgap. Graded bandga p structure has an effect on properties of particles and quasi-particles, such as mobility and intrinsic con- cent...

Ngày tải lên: 20/06/2014, 22:20

... Ruiz Zamarreño, Francisco Javier Arregui and Ignacio Raúl Matías Abstract In this work a novel antibacterial surface composed of an organic-inorganic hybrid matrix of tetraorthosilicate and a polyelectrolyte ... high antibacterial activity. Moreover, a surface can obtain contact bacteria-killing capacity through chemical modification with tethered bactericidal functionalities such as qu...

Ngày tải lên: 21/06/2014, 04:20

... electrochemical transistors were characterized in pH buffers using Samchun Chemical at room tempera- ture using a semiconductor analyzer (HP415 6A, Hew- lett-Packard). Abbreviations CNT-Nafion: carbon nanotube-Nafion; ... a carbon nanotube-Nafion (CNT-Nafion) suspension. Dielectrophoretically aligned nanowires formed a one-dimensional submicron bundle betwe en triangular electrodes. The...

Ngày tải lên: 21/06/2014, 04:20

... product and hence one can easily verify that C ϕ has closed range on A 2 . Zorboska has given a necessary and sufficient condition for C ϕ with closed range on H 2 , and she also has done on A p α 9. ... Theory Advance and Application, pp. 157–167, Birkh ¨ auser, Basel, Switzerland, 2005. 12 L. Liu, G. Cao, and X. Wang, “Composition operators on Hardy-Orlicz spaces,” Acta Math...

Ngày tải lên: 22/06/2014, 02:20

... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT ... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGT...

Ngày tải lên: 19/06/2014, 22:20

... that at the sample bias of 0 V, the quantum capacitance variation of graphene increases with n. With +3 V bias applied, all quantum capacitance variations are much larger than their corre- sponding ... cited. layers are always smaller than those measured on the SiO 2 substrate for both biases. As the capacitance measured on graphene is com- posed of two series capacitance: the quantum cap...

Ngày tải lên: 21/06/2014, 00:20