báo cáo hóa học:" Virology on the Internet: the time is right for a new journal" pdf
... information or misinformation regarding viruses can further exacerbate their impact on public health. There is an urgent need for a rapid forum for communications among virologists. Virology Journal will ... as wealthier ones (although creating access to the Internet is another matter [10]). This is particularly relevant in virology as many viruses have regional, rather th...
Ngày tải lên: 20/06/2014, 04:20
... information or misinformation regarding viruses can further exacerbate their impact on public health. There is an urgent need for a rapid forum for communications among virologists. Virology Journal will ... so an author's work can be read by anyone at no cost. Second, the authors hold copyright for their work and grant anyone the right to reproduce and disseminate t...
Ngày tải lên: 18/06/2014, 22:20
... speaking, the A- harmonic tensors are solutions of the A- harmonic equation, which is intimately connected to the fields, including potential theory, quasiconformal mappings, and the theory of elasticity. ... Nonlinear Potential Theory of Degenerate Elliptic Equations, Oxford Mathematical Monographs, The Clarendon, Oxford, UK, 1993. 15 E. M. Stein, Harmonic Analysis: Real-Varia...
Ngày tải lên: 21/06/2014, 18:20
Báo cáo hóa học: " Research Article Existence and Stability of Antiperiodic Solution for a Class of Generalized Neural Networks with Impulses and Arbitrary Delays on Time Scales" ppt
... solutions for a neutral nonlinear dynamical equation on a time scale,” Journal of Mathematical Analysis and Applications, vol. 319, no. 1, pp. 315–325, 2006. 35 R. Agarwal, M. Bohner, and A. Peterson, ... 1, Journal of Inequalities and Applications 13 It is clear that Ω satisfies all the requirements in Lemma 2.13 and conditionH is satisfied. In view of all the discussion...
Ngày tải lên: 21/06/2014, 07:20
báo cáo hóa học:" Global existence and asymptotic behavior of smooth solutions for a bipolar Euler-Poisson system in the quarter plane" doc
... This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Global existence and asymptotic ... corresponding nonlinear parabolic equation given by the related Darcy’s law, is proven. Finally, the optimal convergence rates of the solutions towards the nonlinear diffusion waves are...
Ngày tải lên: 21/06/2014, 20:20
báo cáo hóa học: " Recruitment and retention of farm owners and workers for a six-month prospective injury study in New Zealand: a feasibility study" pdf
... over. Identification of Farms Contact and demographic information on farms in the Waitaki TLA was obtained from the AgriBase™ data- base, a national database of farm ownership, location and management in New ... corroborated by the majority of participants reporting safety perfor- mance as their main reason for taking part in this study. Reasons for participation As part of t...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Varicella-zoster virus ORF 58 gene is dispensable for viral replication in cell culture" pptx
... G62N4 (gat- caaagcttagcgcag) and G62R4 (cctatagcatggctccag); kan- amycin-resistance gene, KMF (atgattgaacaagatggattg) and KMR (aagaaggcgatagaaggcgatg). The transferred mem- brane was treated with ... Biomedical Research, National Institute of Biomedical Innovation, Osaka, Japan, 2 Kanonji Institute, the Research Foundation for Microbial Diseases of Osaka University, Kanonji, Kagawa, Ja...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Blind recovery of k/n rate convolutional encoders in a noisy environment" pdf
... able for blind identification in a noisy environment: for example, an Euclidean algorithm-based approach was developed and applied to the case of a rate 1/2 con- volutional encoder [13]. At nearly ... identification of convolutional code: method A prerequisite to the extension of the method applied in [8] to the ca se of a rate k/n convolutional encoder is the identifi...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học: " Exponential energy decay and blow-up of solutions for a system of nonlinear viscoelastic wave equations with strong damping" ppt
... internal dissipa- tion acts on a part of Ω and the viscoelastic dissipation acts on the other part. They established both exponential and p olynomial decay results under the conditions on g anditsderivativesuptothethirdorder,whereasBerrimiandMessaoudi[6]allowed the ... relaxation functions. H e established a more general decay result, for which the usual exponential and...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo hóa học: " Application of silver nanofluid containing oleic acid surfactant in a thermosyphon economizer" pdf
... oleic acid surfactant in a thermosyphon economizer Thanya Parametthanuwat 1 , Sampan Rittidech 1* , Adisak Pattiya 2 , Yulong Ding 3 and Sanjeeva Witharana 3 Abstract This article reports a recent ... of Mechanical Engineering, Faculty of Engineering, Mahasarakham University, Thailand Full list of author information is available at the end of the article Parametthanuwat et al. Nanos...
Ngày tải lên: 21/06/2014, 04:20