báo cáo hóa học:" Biobanking after robotic-assisted radical prostatectomy: a quality assessment of providing prostate tissue for RNA studies" docx
báo cáo hóa học:" Biobanking after robotic-assisted radical prostatectomy: a quality assessment of providing prostate tissue for RNA studies" docx
... 17:3344-3350.
doi:10.1186/1479-5876-9-121
Cite this article as: Dev et al.: Biobanking after robotic-assisted radical
prostatectomy: a quality assessment of providing prostate tissue for
RNA studies. Journal of Translational Medicine ... therefore open radical
prostatectomy has been advantageous in allowing the r etrieval of the prostate immediately after...
Báo cáo sinh học: "Biobanking after robotic-assisted radical prostatectomy: a quality assessment of providing prostate tissue for RNA studies" doc
... 17:3344-3350.
doi:10.1186/1479-5876-9-121
Cite this article as: Dev et al.: Biobanking after robotic-assisted radical
prostatectomy: a quality assessment of providing prostate tissue for
RNA studies. Journal of Translational Medicine ... robotic-assisted radical
prostatectomy: a quality assessment of providing
prostate tissue for RNA studi...
báo cáo hóa học:" Lessons to be learned from a missed case of Hamate fracture: a case report" pot
... bats a nd clubs. They are associated with
instability and unless detected and managed appropri-
ately are associated with a poor outcome [2].
Traditionally, fractures and dislocation of the hamate ... We
believe that the standard trauma series should be: PA;
PA with ulnar flexion; medial oblique and lateral X-rays.
With an additional carpal tunnel view where hamate
fracture is suspected...
báo cáo hóa học:" Lessons to be learned from a missed case of Hamate fracture: a case report" ppt
... We
believe that the standard trauma series should be: PA;
PA with ulnar flexion; medial oblique and lateral X-rays.
With an additional carpal tunnel view where hamate
fracture is suspected.
Abbreviations
MCP: ... Hand Surg Eur Vol 2007, 32(6):721-2.
6. Celi J, de Gautard G, Della Santa JD, Bianchi S: Sonographic Diagnosis of a
Radiographically Undiagnosed Hook of the Hamate Fracture. Jo...
báo cáo hóa học:" Male gender predicts mortality in a large cohort of patients receiving antiretroviral therapy in Uganda" ppt
... edward.mills@uottawa.c a
1
Faculty of Health Sciences, University of Ottawa, Ottawa, Canada
Full list of author information is available at the end of the article
Mills et al. Journal of the International AIDS ... JA,
Dabis F, Egger M, IeDEA Southern Africa and West Africa: Prognosis of
patients with HIV-1 infection starting antiretroviral therapy in sub-
Saharan Africa: a col...
Báo cáo hóa học: " Changing patterns in diagnostic strategies and the treatment of blunt injury to solid abdominal organs" docx
... The management of blunt ab dominal injury has changed considerably. Focused assessment with
sonography for trauma (FAST) examination has replaced diagnostic peritoneal lavage as diagnostic modality ... MDCT after blunt trauma:
evaluation of additional findings and impact on patient management.
AJR Am J Roentgenol 2008, 190:1591-1598.
15. Catalano O, Aiani L, Barozzi L, Bokor D, De M...
Báo cáo hóa học: " Research Article Novel Data Fusion Method and Exploration of Multiple Information Sources for " ppt
... (C)TATAAA (A) , TACAAAT, TTAAA,
ATAAATA, TTAAAT, TATAAG
TCF1 1 GTTATTGGTTAAAGAAGTATA,
GTGTAGGTTACTTATTCTCCTTTTGTTGA
TEAD1 2 (AA)CATTCCTT(CGG), AGGAGGAATGTGC
TRP53 2 GAGCAAGTCA, ATACAAGGCC
EURASIP Journal ... ACCCAAATATGGCT, CCTTACATGG,
CCAAGAATGG, CCAAATAAGG,
GCCCATGTAAGGAG, GAAACGCCATATAAGGAGCAGG,
GCAGCGCCTTATATGGAGTGGC, CTCCAAATTTAGGC,
TGCTTCCCATATATGGCCATGT, CCATATTAGG, CTATTATGG
TBP 1 (C)...
Báo cáo hóa học: " Research Article System-Platforms-Based SystemC TLM Design of Image Processing Chains for Embedded Applications" potx
... other hand, system-level design languages facilitate the fast hardware
synthesis at behavioral level of abstraction. In this paper, we introduce an approach for hardware/software codesign of image ... representa-
tion of the hardware. They may be behavioral models as long
as they are cycle-approximate representations of the hard-
ware for the transactions of interest (i.e., the...
báo cáo hóa học:"Personality and the physician-patient relationship as predictors of quality of life of cardiac patients after rehabilitation" pptx
... occasionally income is also
adjusted (cf. [4]), but we are not aware of any study th at
has examined personality variables and SES in parallel
for the prediction of the HRQOL after cardiac rehabili-
tation. ... predictors of quality of life of cardiac patients
after rehabilitation. Health and Quality of Life Outcomes 2010 8:100.
Submit your next manuscript to BioMed Cent...
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... Gonzalez I, Dejean S, Martin P, Baccini A: CCA: An R Package to
Extend CanonicalCorrelation Analysis. Journal of Statistical Soft-
ware 2008, 23(12):1-14.
64. Takakura S, Mitsutake N, Nakashima ... using Trizol reagent and the RNA
quality was tested with the Agilent Bioanalyzer 2000 (Agi-
lent Technologies, Santa Clara, CA). The RNA was ampli-
fied into antisense RNA (aRNA) as prev...