báo cáo hóa học:" A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" doc
báo cáo hóa học:" A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" doc
... Sidransky D: DNA methylation markers in colorectal cancer. Cancer Metastasis Rev 2010, 29:181-206.Figure 6 Changes in intracellular localization according to KIAA0247 expression and 5-FU treatment. ... Capdevila J, Saura C, Tabernero J: Novel targets foranticancer treatment development in colorectal cancer. Clin Colorectal Cancer 2006, 6:265-272.7. Voutsadakis IA: Pathogenesis of colorectal ... 9:82http://www.translational-medicine.com/content/9/1/82Page 2 of 8RESEARCH Open Access A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatmentChi-Jung Huang1,2,3,...
- 8
- 356
- 0
Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt
... Sidransky D: DNA methylation markers in colorectal cancer. Cancer Metastasis Rev 2010, 29:181-206.Figure 6 Changes in intracellular localization according to KIAA0247 expression and 5-FU treatment. ... 9:82http://www.translational-medicine.com/content/9/1/82Page 2 of 8RESEARCH Open Access A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatmentChi-Jung Huang1,2,3, ... 82R: CTCATGCTTCTTTCAACAGTGGCyclin A2 NM001237 F: CCATACCTCAAGTATTTGCCATC 67(CCNA2) R: TCCAGTCTTTCGTATTAATGATTCAGCyclin B1 NM031966 F: CATGGTGCACTTTCCTCCTT 18(CCNB1) R: AGGTAATGTTGTAGAGTTGGTGTCCCyclin...
- 8
- 357
- 0
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot
... and Aurora -A kinase. (D) Low power (2×) image of ovarian tissue microarray stained for Aurora A by immunohistochemistry. (E) Aurora -A staining of TMA core of ovarian carcinoma without adjuvant ... of total cells positive for Aurora -A, and data averaged for eachpatient's cores. The TMA staining data, including detailedpatient information is summarized in Table 3. On aver-age, the ... Hirota T, Kunitoku N, Sasayama T, Marumoto T, Zhang D, Nitta M,Hatakeyama K, Saya H: Aurora -A and an interacting activator,the LIM protein Ajuba, are required for mitotic commit-ment in human cells. ...
- 13
- 475
- 0
Báo cáo hóa học: " LEF-1 and TCF4 expression correlate inversely with survival in colorectal cancer" pptx
... clinical dataof patients and performed statistical data analysis. AJ and TK coordinatedthe study and were involved in drafting the manuscript and revised itcritically. All authors read and approved ... coordinatedimmunohistochemical examinations of tumor specimens and data analysis,and drafted the manuscript. DH participated in the interpretation of dataand conducted immunohistochemistry analysis. JE ... Ba Y, Tonoki H, Tada M, Nakata D, Hamada J, Moriuchi T: Transcriptionalslippage of p53 gene enhanced by cellular damage in rat liver:monitoring the slippage by a yeast functional assay. Mutat...
- 8
- 664
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt
... data andwriting the manuscript. MU was involved in the overall supervision,preparation of the questionnaire and collection and analysis of data. TA wasinvolved in the study design, analysis ... gm/dl (bilateral), with a mean drainage of 826 ml (unilateral) and 1288 ml (bilateral) (p-value < 0.001).Interpretation: Tranexamic acid is effective in reducing post-operative drainage and requirement ... conservation andtheir complicationsAlternatives used to avoid allogenic blood transfusions and theirdisadvantagesPreoperative BloodDonation (PAD)• Cardiac, Vasovagal (Risk Factors: YoungerAge,...
- 5
- 447
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" pdf
... prophylaxis with Injec-tion Enoxaparin 40 mg subcutaneous once a day. Anaes-thesia was standardized and all patients receivedepidural anaesthesia according to standard practice.Patients receiving ... during andafter total knee replacementYasir J Sepah1, Masood Umer2*, Tashfeen Ahmad3, Faria Nasim1, Muhammad Umer Chaudhry1andMuhammad Umar4AbstractBackground & Purpose: Allogenic ... unilateral and bilateralcases was 1.79 gm/dl and 2.21 gm/dl, with a mean post-operative drainage of 1828 ml (unilateral) and 2695 ml(bilateral). In comparison, the mean drop in the post-op haemoglob...
- 5
- 409
- 0
Báo cáo khoa học: The mitochondrial protein frataxin is essential for heme biosynthesis in plants potx
... the activitydetected can be attributed mainly to catalases.Total catalase activity was determined in leaves andflowers from AtFH-deficient lines. In both lines, a decrease of 20% in catalase activity ... to thetotal catalase activity (Fig. 6A) . In agreement with thedata shown in Fig. 5A, we also observed a decrease in catalase activity in Arabidopsis cells. On the otherhand, an almost complete ... ProcNatl Acad Sci USA 97, 12239–12243.15 Busi MV, Maliandi MV, Valdez H, Clemente M,Zabaleta EJ, Araya A & Gomez-Casati DF (2006)Deficiency of Arabidopsis thaliana frataxin alters activityof...
- 12
- 517
- 0
báo cáo hóa học: " Influence of virtual reality soccer game on walking performance in robotic assisted gait training for children" doc
... SK, AMH and LJ assisted withdata interpretation as well as in revising the manuscript. All authors read andapproved the final manuscript.AcknowledgementsWe are grateful for financial support ... adopting a VR scenario during RAGT based on the individual's levelof active participation and compared this to a regulartraining session involving therapist encouragement andmotivation. ... environment in RAGT, on theother hand, has the potential to constantly enhance andadapt training motivation and therefore increase activeparticipation and training outcome. Moreover, VR mayalso...
- 9
- 431
- 0
báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc
... remained constant,while other genes were varying in expression according toaccumulation of infected cells. The experimentally obtained data for each virus and eachgene were analysed using ... all, β-actin is an unsuitable asreference gene, whereas TATA-Box binding protein and peptidyl-prolyl-isomerase A are stablereference genes for expression studies in virus infected cells. BackgroundQuantitative ... like β2M and GAPwere also acceptable regarding to a stable expression in virus infected cells. All other genes showed moderateexpression stability.The analysis of our data set according to the...
- 5
- 539
- 0
báo cáo hóa học:" The use of beta-tricalcium phosphate bone graft substitute in dorsally plated, comminuted distal radius fractures" doc
... out at every visit. Radiological evaluation includedfrontal and lateral standard views. Articular surface,intraarticular steps, height of the radius, radial inclination,ulnar variance and palmar ... pronation and supina-tion as well as ulnar and radial abduction. Grip strengthwas measured using JAMAR dynamometer and comparedto the opposite side. A neurological examination was alsocarried ... bone aug-mentation mainly supports the central articular surface.Another aspect is a possible weakness of the material afterhardware removal. In case of incomplete integration addi-tional loss...
- 5
- 363
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM