báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot

báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot

báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot

... 1312:237-242. doi:10.1186/1479-5876-9-46 Cite this article as: Xu et al.: Comparisons of three polyethyleneimine- derived nanoparticles as a gene therapy delivery system for renal cell carcinoma. Journal of Translational Medicine ... S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor 3 as a potential t...

Ngày tải lên: 20/06/2014, 03:20

10 306 0
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc

Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc

... 1312:237-242. doi:10.1186/1479-5876-9-46 Cite this article as: Xu et al.: Comparisons of three polyethyleneimine- derived nanoparticles as a gene therapy delivery system for renal cell carcinoma. Journal of Translational Medicine ... S, Kashima T, Tomita K, Kitamura T, Kodama T, Fukayama M, Aburatani H: Identification of Toll-like receptor 3 as a potential t...

Ngày tải lên: 18/06/2014, 19:20

10 453 0
Báo cáo hóa học: " Periodically Aligned Si Nanopillar Arrays as Efficient Antireflection Layers for Solar Cell Applications" ppt

Báo cáo hóa học: " Periodically Aligned Si Nanopillar Arrays as Efficient Antireflection Layers for Solar Cell Applications" ppt

... turn. The fabrication of PASiNP-based solar cell is similar to the traditional Si solar cell technology. After removal of residual PS spheres and silver particles on the surface of PASiNP arrays, a thin ... PEC measurement of PASiNP array–based solar cell was performed using a solar simulator under Air Mass (AM) 1.5 G illumination with intensity of 100 mW/cm 2 . Results an...

Ngày tải lên: 21/06/2014, 07:20

6 268 0
Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

... this was the last day w ith at least four data points for the untreated group; day 23 was used for vincristine (last Table 1 Average Score and Number of Cystadenomas per Kidney for A/ J and C57BL/6 ... as single agents and in combination with rapamycin. We found that asparaginase, sunitinib, and bevacizumab are effective as single agents, but not as eff ective as rapamycin. V...

Ngày tải lên: 18/06/2014, 16:20

18 612 0
báo cáo hóa học:" Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" doc

báo cáo hóa học:" Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" doc

... 2304 T2S59 GCGUGA UCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C12 GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C18 ... 2304 T1L GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUAC...

Ngày tải lên: 20/06/2014, 04:20

17 282 0
báo cáo hóa học:" Treatment of chronic lateral ankle instability: a modified broström technique using three suture anchors" pot

báo cáo hóa học:" Treatment of chronic lateral ankle instability: a modified broström technique using three suture anchors" pot

... retinaculum to leave a cuff of tissue for advancement, 2) careful and accurate periosteal dissection of the capsule off the fibula in order to preserve adequate length for repair, 3) always evaluate Two ... confluence of the proximal aspect of the ATFL ligament with the lateral ankle capsule. This is an important step because in patients with lateral ankle instability and tear...

Ngày tải lên: 20/06/2014, 04:20

6 391 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot

Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot

... de Oliveira CA, Azaiez H, Brownstein Z, Avenarius MR, Marlin S, Pandya A, Shahin H, Siemering KR, Weil D, Wuyts W, Aguirre LA, Martín Y, Moreno- Pelayo MA, Villamar M, Avraham KB, Dahl H-HM, Kanaan ... M, Daneshi A, Farhadi M, Mohseni M, Mahdieh N, Ebrahimi A, Bazazzadegan N, Naghavi A, Avenarius M, Arzhangi S, Smith RJ: GJB2 mutations: passage through Iran. Am J Med Genet A 2005, 13 3...

Ngày tải lên: 18/06/2014, 16:20

7 695 0
Báo cáo hóa học: " Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4" potx

Báo cáo hóa học: " Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4" potx

... 5’-AGCT TTTGGAAAAAATTGAAACT GCAATCAA- GAGTGCGGATATCAACACTCTTGATTGCAGTTT- CAACGG-3’;5’-GATCCCATTCGCCAAGCAATGGAAC TTGATATCCGGTTCCATTGCTTGGCGAA TTTTT TTCCAAA-3’and 5’-AGCTTTTGGAAAAAAATTCGC- CAAGCAATGGAACCG ... CGGCATAGAGGTAGTTCCTAATATTTTTTC- CAAA-3’ and 5 ’-AGCTTTTGGAAAAA ATATTAGG AACTACCTCTATGCCGGATATCAAGCATAGAGG- TAGTTCCTAATA CGG-3’ ;5’-GATCCCGTTGAAAC TGCAATCAAGAGTGTTGATATCCGCACTCTTG ATTGCAGTT...

Ngày tải lên: 18/06/2014, 16:20

8 489 0
Báo cáo hóa học: " Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer" pdf

Báo cáo hóa học: " Detection of EGFR mutations with mutation-specific antibodies in stage IV non-small-cell lung cancer" pdf

... mutations. J Thorac Oncol 2010, 5:1551-1558. 21. Kawahara A, Yamamoto C, Nakashima K, Azuma K, Hattori S, Kashihara M, Aizawa H, Basaki Y, Kuwano M, Kage M, et al: Molecular diagnosis of activating ... Madrid, Spain. 4 Hospital San Carlos, Madrid, Spain. 5 Hospital La Princesa, Madrid, Spain. 6 Hospital Lozano Blesa, Zaragoza, Spain. 7 Hospital General de Valencia, Valencia, Spain. 8 Hospi...

Ngày tải lên: 18/06/2014, 16:20

8 798 0
w