báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx
báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx
... quantitative PCR in several human CD8 + T cell subsets defining the major steps of the T cell differentiation pathway. Results: We found expression of a limited set of microRNAs, including the ... relationship between differentiation and functional properties. In that respect, it might therefore be helpful to elaborate better vaccination strategies for induction of...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc
... quantitative PCR in several human CD8 + T cell subsets defining the major steps of the T cell differentiation pathway. Results: We found expression of a limited set of microRNAs, including the ... lym- phocyte biology will help to better define CD8 + T cell differentiation, and might shed light on the relationship between differentiation and functional properties....
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Enhanced serum concentrations of transforming growth factor-beta1 in simple fatty liver: is it really benign?" pot
... diagnosis. Measurements: Serum concentrations of transforming growth factor-beta1 and ferritin. Results: High concentrations of transforming growth factor-beta1 were noticed in patients suffering from both fatty ... randomized determination mirror the "at steady state" serum concentration of this cytokine? TGF-β1 differs from the majority of growth regulatory fac- tors sin...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics" ppt
... proportion of subjects with aminoglycoside ototoxicity in this cohort may contribute to higher incidence of the 1555A > G mutation than other cohorts. On the other hand, the incidences of the 1494C ... > T mutation appeared to be lower than those of the 1555A > G mutation. In this cohort, two subjects carrying the 1494C > T mutation had a history of exp o- sure t...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx
... instruction that the patients should think of the period before the fracture, and in most of the patients, GQOL was assessed within the first two weeks after the fracture. It seems unlikely that the ... within the same time before the fracture. Studies have shown that patients tend to think of the time before the event regardless of the instructions specifying "the time before&...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... continue to indicate restric- tion in at least one aspect of life at three years, have indi- cated recovery and onset of restriction in different areas to those indicated at baseline. However these ... calculated as those with restriction in an aspect of life at both baseline and follow-up. To examine the link between onset of restriction in each aspect of life and amount o...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx
... significant for all tested variables, p < 0.01 (Table 2). We then again tested for test-retest stability but this time within the second and third trials in the third test session (Table 1, ... systematic training arena and an assessment tool [7]. The potential of VR to identify the underlying deficit can facilitate the planning of clinically relevant intervention programmes targeted...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Bayesian bias adjustments of the lung cancer SMR in a cohort of German carbon black production workers" pdf
... are interested in P(para- meters | data), that is the posterior distribution of the param eters. The factor 1/P(da ta) is often called the pro- portionality factor and this factor links the posterior with ... by the prior data. Defining and applying a full distribution and not only a point estimate for, say, prop smoke, coh has the advantage of taking the uncer- tainty of this paramet...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot
... CAGGAAAGTCAGCTGCTATC MMP 3 FOR ATGGCATCCAGTCCCTGTAT 161 86.5 RC AAAGAACAGGAACTCTCCCC MMP 13 FOR TCTGGTCTTCTGGCTCATGC 141 82.7 RC GGTCAAGACCTAAGGAGTGG ADAMTS4 FOR CATCACTGAGTTCCTGGACA 106 84.5 RC CGATCAGCGTCATAGTCCTT ADAMTS5 ... prevention and treatment of OA in the earli- est stages of disease. Competing interests The author(s) declare that they have no competing inter- ests. Authors&ap...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " A pandemic strain of calicivirus threatens rabbit industries in the Americas" doc
... DRAWTREE was used to display the results. Competing interests The author(s) declare that they have no competing inter- ests. Authors' contributions SAM contributed in conception of the study. ... http://www.virologyj.com/content/4/1/96 Page 8 of 13 (page number not for citation purposes) in nature is in spite of the fact that much of Europe vacci- nates rabbits with a vacci...
Ngày tải lên: 20/06/2014, 01:20