0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases" ppt

báo cáo hóa học:

báo cáo hóa học:" A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases" ppt

... A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases. Journal of TranslationalMedicine 2011 9:43.Submit ... combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant casesChong Xie1, Hyun J Kim2, Jonathan G Haw3, Anusha Kalbasi3, Brian K Gardner4, ... monoclonal Abagainst human PSA (Biocon, Inc. Rockville, MD) toquantify total PSA levels. sero MAP-based PSA quantifi-cation was compared with standard ELISA-based PSA assays (American Qualex) and...
  • 11
  • 434
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases" docx

... 9:43http://www.translational-medicine.com/content/9/1/43Page 3 of 11RESEARCH Open Access A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from ... A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases. Journal of TranslationalMedicine 2011 9:43.Submit ... humanIgGandPSAweremixedinthemultiplexassaytoaccommodate staining of autoAb and PSA binding todistinct seroMAP regions, allowing simultaneous quanti-fication of autoAb plus PSA in one reaction (termed the A+ PSA assay) .To...
  • 11
  • 915
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx

... image andthe global mean of regional standard deviation of theimage. This quantitative method is an efficient way toquantitatively evaluate the image quality after imageenhancement in a 2D ... local contrast at allregional signal average levels within the 8-bit dynamicrange of most video cameras so that image features anddetails are clearly visible in both dark and light zones of the ... Reza MAli: Realization of the contrast limited adaptive histogramequalization (CLAHE) for real-time image enhancement. J VLSI SignalProcess 2004, 38(1):35-44.12. Tao L, Asari VK: Adaptive and...
  • 19
  • 353
  • 0
báo cáo hóa học:

báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" pptx

... we can see that the parameter Sigmasignificantly influences the image contrast after enhance-ment processing. A smaller (larger) value of Sigma leadsto a smal ler (larger) value of overall ... local contrast at allregional signal average levels within the 8-bit dynamicrange of most video cameras so that image features anddetails are clearly visible in both dark and light zones of the ... 24:1663-1677.doi:10.1186/1687-5281-2011-6Cite this article as: Tsai and Chou: A novel simultaneous dynamic rangecompression and local contrast enhancement algorithm for digitalvideo cameras. EURASIP Journal on Image and Video Processing...
  • 19
  • 463
  • 0
báo cáo hóa học:

báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx

... (HLA -A) ,5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA-B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT-GCCAATCTCATCTT-3' ... were: 5'-GAGA-CATCTTGGAACTGGAC-3' and 5'-CTCTGAGTGA-GAATCTGAGC-3' (forward and reverse, TAP1), 5'-GTACAACACCCGCCATCAG-3' and 5'-GGACGTAGGG-TAAACGTCAGC-3' ... 5'-GGACGTAGGG-TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT-3' and 5'-AAGACCAGTCCTTGCTGA-3' (β2m), 5'-TAT-AGTCGACCACCCGGACTCAGAATCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3'...
  • 13
  • 529
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel asynchronous access method with binary interfaces" doc

... proposedmethod for asynchronous access is expected to have a bet-ter performance in a real application.trtrRelative performance Γ for all sets of parameters = {σ, ω, τ} evaluatedFigure 7Relative ... button of a computer mouse or a single keyboard key. Figure 8 depicts a sample drawingmade by a minimal interface user by means of this soft-ware application. A particular implementation of the ... access method offers a variety of advantages over traditionallysynchronous access strategies and may be adapted to a wide variety of contexts, with primaryrelevance to applications involving...
  • 19
  • 356
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx

... materialAcknowledgementsThe authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work.References1. ... conceived of the study,participated in the design, statistical analyses of the studyand helped to draft the manuscript. All authors read andapproved the final manuscript.Additional materialAcknowledgementsThe ... testsThe correlation analyses of the sensorimotor variablesrevealed that repositioning VE and ROM from the cervicalrotation test and Ra and Tr area from the postural sway testPerformance of the exercise...
  • 10
  • 712
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

... Strasbourg, FranceEmail: Laurent Mailly - Laurent.Mailly@viro-ulp.u-strasbg.fr; Charlotte Boulade-Ladame - boulade@esbs.u-strasbg.fr; Georges Orfanoudakis - orfanoudakis@esbs.u-strasbg.fr; François ... 95(5):2509-2514.3. Hanahan D: Studies on transformation of Escherichia coli withplasmids. J Mol Biol 1983, 166(4):557-580.4. Renaut L, Bernard C, D'Halluin JC: A rapid and easy method for production and ... Ad5-TK/EGFPCAd5-E6mutMockE6mut (18 kDa , Anti-Flag)DCMV promoterSwaIBstBIClaIAmpRPacIPacIITRITRpAd5CMV/TCSAnti-TKEGFPHoechstMockAd5-EGFPAd5-TKAd5-TK/EGFPAnti-E6Anti-FlagAd5-E6mutMockHoechstSwaIBstBIClaI...
  • 4
  • 451
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... bp amplicon)Ty 2353+ CTGAATGTTTGCATGGAAATGTGC 200 nMTy321- GGTCGCTTCGACATARTCACG 200 nMSequencing of TYLCV cloned sequencespGreen1589 (+) CACGACGTTGTAAAACGACGpG1825(-) CACAGGAAACAGCTATGACC579 ... A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original ... in a 1/100 dilution of a mock-DNA extract from healthy tomato plants. The number of actin2 genewas assessed with a standard curve obtained with a serialtenfold dilution of a plasmid containing...
  • 10
  • 396
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A novel cross-layer mesh router placement scheme for wireless mesh networks" pptx

... maximum traffic demand of user i;rij: transmission rate between user i and MR j;Cmax: maximum link capacity of a local accessantenna;Rj: local coverage of MR j;Rmax: maximum local ... that interfere MR k andMR l is the uplink MR of MR k;Ĉk: backbone uplink capacity ofaggregate backbonetraffic MR k;Ĉmax: maximum backbone link capacity of a back-bone access antenna ... 802.16 - Standard for local and metropolitan area networks, Part 16: AirInterface for Broadband Wireless Access Systems (2004)35. H-Y Wei, S Ganguly, R Izmailov, ZJ Haas, Interference-aware IEEE...
  • 14
  • 426
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ