Báo cáo hóa học: " HIV-1 designed to use different tRNAGln isoacceptors prefers to select tRNAThr for replication" ppt

Báo cáo hóa học: "Epigenetic change in E-Cardherin and COX-2 to predict chronic periodontitis" pptx

Báo cáo hóa học: "Epigenetic change in E-Cardherin and COX-2 to predict chronic periodontitis" pptx

... in cancer initiation [34]. Although the effect of IL-6 to cancer is s till unknown, this cytokine may provide a link from bacterial infection to inflammation and cancer. Changes and damages in cells ... 8:110 http://www.translational-medicine.com/content/8/1/110 Page 5 of 6 RESEARC H Open Access Epigenetic change in E-Cardherin and COX-2 to predict chronic periodon...

Ngày tải lên: 18/06/2014, 16:20

6 422 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

... social support and sense of coherence on health-related quality of life among nursing home residents – a questionnaire survey in Bergen, Norway. International Jour- nal of Nursing Studies in press. ... defined mentally intact as having a Clinical Dementia Rating (CDR) ≤ 0.5 [22], which was assessed by trained nurses who knew the residents well....

Ngày tải lên: 18/06/2014, 19:20

9 845 0
Báo cáo hóa học: " Beyond satisfaction: Using the Dynamics of Care assessment to better understand patients'''' experiences in care" pptx

Báo cáo hóa học: " Beyond satisfaction: Using the Dynamics of Care assessment to better understand patients'''' experiences in care" pptx

... analysis of the Dynamics of Care We conducted a series of analyses on the Dynamics of Care assessment to better understand the psychometric Table 3: Rates of Selection of Areas to Probe in Dynamics of ... perceptions of experiences in care, the Dynamics of Care (DoC) assessment. It is an in- depth approach to defining and assessing...

Ngày tải lên: 18/06/2014, 22:20

20 551 0
Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf

Báo cáo hóa học: " Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats" pdf

... 8:13 http://www.jneuroengrehab.com/content/8/1/13 Page 7 of 8 RESEARC H Open Access Complexity of VTA DA neural activities in response to PFC transection in nicotine treated rats Ting Y Chen, Die Zhang, Andrei Dragomir, Yasemin M Akay, Metin Akay * Abstract Background: ... the complexity of firing of the VTA DA neuron and this alteration should be based...

Ngày tải lên: 19/06/2014, 08:20

8 403 0
báo cáo hóa học: " Knowledge discovery in databases of biomechanical variables: application to the sit to stand motor task" docx

báo cáo hóa học: " Knowledge discovery in databases of biomechanical variables: application to the sit to stand motor task" docx

... The kinematics of, and the dynamic actions on, the CM of the modelled portion of the body involved in the movement are needed as model inputs. The outputs of the TIPs are the kinematic and kinetic ... values, showing a high level of repeatability of the timing of the performance of the task. Conclusions: The distinctive patterns of the sit -to-...

Ngày tải lên: 19/06/2014, 10:20

10 381 0
báo cáo hóa học: " Effects of the physiological parameters on the signal-to-noise ratio of single myoelectric channel" doc

báo cáo hóa học: " Effects of the physiological parameters on the signal-to-noise ratio of single myoelectric channel" doc

... a contraction. The major findings include: 1. The SNR of a single ME channel is highly related to the stimulus intensity of the motoneuron, which carries the information of the voluntary contraction ... a contraction [18-20]. Some modelling work on motoneuron firing patterns sug- gested that the range of the firing rate of the motoneuron during a steady contrac...

Ngày tải lên: 19/06/2014, 10:20

10 387 0
báo cáo hóa học: " Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" doc

báo cáo hóa học: " Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" doc

... other clinically defined PD groups. Discussion Our finding of an overall correlation between aSN depo- sition and MHCII-expressing microglia in the substantia nigra is in line with the finding ... Neuroinflammation Open Access Research Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition Emilie Croisier 1 , Lind...

Ngày tải lên: 19/06/2014, 22:20

8 403 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...

Ngày tải lên: 19/06/2014, 22:20

8 447 0
báo cáo hóa học: " Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b" pot

báo cáo hóa học: " Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b" pot

... article as: Kauppinen et al.: Poly(ADP-ribose)polymerase-1 modulates microglial responses to amyloid b. Journal of Neuroinflammation 2011 8:152. Submit your next manuscript to BioMed Central and take ... comparisons (Table 3). PARP-1 modulates microglial trophic factor release Activated microg lia can also release, in addition to neu- rotoxic agents, several cytokines and...

Ngày tải lên: 19/06/2014, 22:20

17 224 0
báo cáo hóa học: " Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide" ppt

báo cáo hóa học: " Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide" ppt

... made available soon. Insulin-like growth factor-I peptides act centrally to decrease depression-like behavior of mice treated intraperitoneally with lipopolysaccharide Journal of Neuroinflammation ... activation of the innate immune system of the brain which is tempered by GPE (Fig. 5). Decreased neuroinflammation in response to IGF-I Figure 3 1 Insu...

Ngày tải lên: 19/06/2014, 22:20

38 340 0
Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

... Access Research Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study Mir Saeed Attarchi* 1 , Omid Aminian 2 , Mandana Dolati 3 and ... of Health & Medical Education, Tehran, Iran Email: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Man...

Ngày tải lên: 20/06/2014, 00:20

6 380 0
Báo cáo hóa học: "Assessment of nutritional knowledge in female athletes susceptible to the Female Athlete Triad syndrome" pot

Báo cáo hóa học: "Assessment of nutritional knowledge in female athletes susceptible to the Female Athlete Triad syndrome" pot

... Abstract Background: The study aimed to i) assess nutritional knowledge in female athletes susceptible to the Female Athlete Triad (FAT) syndrome and to compare with controls; and ii) to compare nutritional knowledge ... observable in the young female non -athlete population. In terms of intervention, if optimising performance is the dominant fa...

Ngày tải lên: 20/06/2014, 00:20

11 475 0
Báo cáo hóa học: " HIV-1 designed to use different tRNAGln isoacceptors prefers to select tRNAThr for replication" ppt

Báo cáo hóa học: " HIV-1 designed to use different tRNAGln isoacceptors prefers to select tRNAThr for replication" ppt

... that use reverse BioMed Central Page 1 of 7 (page number not for citation purposes) Virology Journal Open Access Research HIV-1 designed to use different tRNA Gln isoacceptors prefers to select ... preferred by HIV-1 for replication indi- cating that HIV-1 prefers tRNA Thr as a primer for replica- tion. The results of our study re-enforces the idea that HIV-1...

Ngày tải lên: 20/06/2014, 02:20

7 246 0
Báo cáo hóa học: " CT angiography predicts use of tertiary interventional services in acute ischemic stroke patients" pptx

Báo cáo hóa học: " CT angiography predicts use of tertiary interventional services in acute ischemic stroke patients" pptx

... Thomas et al.: CT angiography predicts use of tertiary interventional services in acute ischemic stroke patient s. International Journal of Emergency Medicine 2011 4:62. Thomas et al. International ... al. International Journal of Emergency Medicine 2011, 4:62 http://www.intjem.com/content/4/1/62 Page 6 of 7 ORIGINAL RESEARCH Open Access CT angiography predi...

Ngày tải lên: 20/06/2014, 22:20

7 260 0
Báo cáo hóa học: " Integrating a Trust Framework with a Distributed Certificate Validation Scheme for MANETs" ppt

Báo cáo hóa học: " Integrating a Trust Framework with a Distributed Certificate Validation Scheme for MANETs" ppt

... to any weak inter- pretation of trust. In our case, ATF acts as the trust plane and ADOPT as a trust- aware application. When integrating the ATF trust plane with the ADOPT scheme, several performance ... ayer Network layer Link layer Physical layer (a) TApplication layer TTransport layer TNetwork layer TLink layer TPhysical layer Trust plane TApplication layer TTransport la...

Ngày tải lên: 22/06/2014, 22:20

18 183 0
Từ khóa:
w