Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

... of 3.01 ± 1.86 years. The age of onset was unclear in the remaining 89 cases. In addition, 79 cases (22 prelingual cases and 57 postlingual cases) had clear histories of administration of aminoglycoside, ... [61]. A diagnosis of digenic inherited GJB2 and GJB3 hearing loss was made in this patient. The frameshift mutation 24_49ins26bp (GCCATGGACTGGAAGACACTCCAGGC) generates...

Ngày tải lên: 18/06/2014, 15:20

12 511 0
báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

... different kind of cancer, but the available data are scarce [18,19]. In a series of 26 gastric cancer patients, Survivin mRNA (as measured by means of ELISA-based qrtPCR) in the peripheral blood has ... H, Saikawa Y, Suda K, Ando T, Kumagai K, Irino T, Yoshikawa T, Matsuda S, et al.: Clinical signifi- cance of circulating tumor cells in blood from patients with gastrointestina...

Ngày tải lên: 18/06/2014, 15:20

8 566 0
Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot

... spectra were recorded for each sample). All samples were analyzed in a random sequence to avoid a possible batch effect. Data Processing and Statistical Analysis The preprocessing of spectral data ... this article as: Pietrowska et al., Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early- stage breast cancer Journa...

Ngày tải lên: 18/06/2014, 16:20

11 391 0
báo cáo hóa học: " Fractal time series analysis of postural stability in elderly and control subjects" pot

báo cáo hóa học: " Fractal time series analysis of postural stability in elderly and control subjects" pot

... Corresponding author †Equal contributors Abstract Background: The study of balance using stabilogram analysis is of particular interest in the study of falls. Although simple statistical parameters ... compares two methods of calculating H: Detrended Fluctuation Analysis (DFA) and Stabilogram Diffusion Analysis (SDA) for elderly and control subjects, as well as evaluating the...

Ngày tải lên: 19/06/2014, 10:20

12 587 0
báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

... protein) in the brains of AD subjects as causes of the disease, with both triggering inflammation and disrupting neuronal signalling, and SP also implicated in genetic mutations of familial AD [3]. Our ... suggest that these are simply a consequence of brain aging without any relationship to clinical AD. The co nversion of these pathways into those causing AD, however, are yet...

Ngày tải lên: 19/06/2014, 22:20

9 290 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T. Ogura et al. Molting ... body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA), and L....

Ngày tải lên: 07/03/2014, 21:20

15 564 0
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

... suggesting that GBE50 prevented the harm caused by an HFD. In addition, we found no significant alterations in the levels of alanine aminotransferase, aspartate amino- transferase or creatinine kinase ... Acacb, Acbd6 (acyl-CoA-binding domain containing 6), Scd2 (stearoyl-CoA desaturase 2) or associated genes, Sorbs3 (sorbin and SH3 domain containing 3) and Etnk1_predicted (ethanolamine...

Ngày tải lên: 16/03/2014, 04:20

9 507 0
Báo cáo khoa học: "Free Indexation: Combinatorial Analysis and A Compositional Algorithm*" doc

Báo cáo khoa học: "Free Indexation: Combinatorial Analysis and A Compositional Algorithm*" doc

... exactly the same number of indexings as demanded by combinatorial analysis. 5 Conclusions This paper has shown that free indexation pro- duces an exponential number of indexings per phrase ... exhibit a provably optimal free indexation al- gorithm. 1 Introduction In the principles-and-parameters model of lan- guage, the principle known as 'free indexation' plays a...

Ngày tải lên: 17/03/2014, 20:20

6 272 0
báo cáo hóa học:" KSP inhibitor ARRY-520 as a substitute for Paclitaxel in Type I ovarian cancer cells" potx

báo cáo hóa học:" KSP inhibitor ARRY-520 as a substitute for Paclitaxel in Type I ovarian cancer cells" potx

... University of Alabama, Birmingham, AL, USA and 4 Department of Pharmacology, Array BioPharma, Boulder, CO, USA Email: Ki Hyung Kim - ghkim@pusan.ac.kr; Yanhua Xie - yanhua.xie@yale.edu; Ewan M Tytler ... Kyungjin K, Visintin I, Fu HH, Brown D, Mor G: NV-128, a novel isoflavone derivative, induces caspase-independent cell death through the Akt/ mammalian target of rapamycin pathway....

Ngày tải lên: 18/06/2014, 15:20

9 538 0
báo cáo hóa học:" Intrinsic and extrinsic factors influencing the clinical course of B-cell chronic lymphocytic leukemia: prognostic markers with pathogenetic relevance" docx

báo cáo hóa học:" Intrinsic and extrinsic factors influencing the clinical course of B-cell chronic lymphocytic leukemia: prognostic markers with pathogenetic relevance" docx

... leukemia: a risk-matched analysis based on the VH gene mutational status. Blood 2004, 103:2850-2858. 79. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T: Class switch recombination ... Garcia-Gila M, Sanz L, Gar- cia-Marco J, Silva A, Garcia-Pardo A: Engagement of alpha4beta1 integrin by fibronectin induces in vitro resistance of B chronic lymphocytic leukemi...

Ngày tải lên: 18/06/2014, 15:20

14 640 0
w