Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf

Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf

Báo cáo hóa học: " Evidence of structural genomic region recombination in Hepatitis C virus" pdf

... 2 Department of Biochemistry and McGill Cancer Center, McGill University, Montreal, Quebec, H3G 1Y6, Canada Email: Juan Cristina* - cristina@cin.edu.uy; Rodney Colina - rcolina@cin.edu.uy * Corresponding ... BioMed Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Evidence of structural genomic region recombination in Hepati...

Ngày tải lên: 20/06/2014, 01:20

8 247 0
báo cáo hóa học:" Evaluation of deformity and hand function in cerebral palsy patients" pdf

báo cáo hóa học:" Evaluation of deformity and hand function in cerebral palsy patients" pdf

... wyip@hkucc.hku.hk; Shew Ping Chow - spchow@hkucc.hku.hk * Corresponding author Abstract Background: A cross-sectional study was performed to describe the upper limb deformity and function in cerebral ... assessment of muscle tone and motor control. Classi- fication of typical contracture and deformity was done in anatomic parts using the following: Gschwind & Tonkin [2] for the f...

Ngày tải lên: 20/06/2014, 01:20

9 514 0
Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx

Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx

... used to describe the course of viraemia in chronically infected people in The Gambia. The results of the cross-sectional study suggest that the characteristics of chronic HBV infection changes as ... chronic infection is 10– 15% of the adult population [2,3]. Chronically infected carriers have a high risk of developing liver damage and hepatocellular carcinoma (HCC) and liver ca...

Ngày tải lên: 20/06/2014, 01:20

7 430 0
báo cáo hóa học:" Evidence of HIV exposure and transient seroreactivity in archived HIV-negative severe hemophiliac sera" ppt

báo cáo hóa học:" Evidence of HIV exposure and transient seroreactivity in archived HIV-negative severe hemophiliac sera" ppt

... of HIV-infection exceeding 90% and those receiving comparable doses of PCCs had a cumulative incidence exceeding 50% [3,4]. This clearly demonstrates the prevalence of infectious HIV in the United ... 50–150% ** Inhibitor indicates the presence of a circulating antibody against the deficient factor; for patients with hemophilia A, an inhibitor often necessitates the use of PCC in...

Ngày tải lên: 20/06/2014, 04:20

11 329 0
Báo cáo khoa học: Characterization of structural and catalytic differences in rat intestinal alkaline phosphatase isozymes pdf

Báo cáo khoa học: Characterization of structural and catalytic differences in rat intestinal alkaline phosphatase isozymes pdf

... lLof50mm CB buffer containing the indicated amounts of MgCl 2 and ⁄ or ZnCl 2. The reactions were star- ted by the addition of 60 lL of CB buffer containing 50 mm p-NPP at 37 C and monitored spectrophotometri- cally ... Kantrowitz ER (1993) Conversion of a magnesium binding site into a zinc binding site by a single amino acid substitution in Escherichia coli alka- line phosphatase....

Ngày tải lên: 07/03/2014, 17:20

10 530 0
báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc

báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc

... neurotrophon-3-supplemented hyaluronic acid (HA)-collagen composite scaffold and light microscopy of NSC in cultureFigure 2 Representative image of scanning electron microscopy of neural stem cell (NSC) at passage ... thickness, cir- Immunofluorescence staining of β-tubulin, glial fibrillary acidic protein (GFAP) and galactocerebroside (GalC) in neurosphere-derived cells cultured...

Ngày tải lên: 18/06/2014, 15:20

11 1K 0
Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

... untreated control group, single agent rapamycin, single agent aspara ginase, combination asparag inase plus rapamycin, single agent vincristine, combination vincristine plus rapamycin, single agent ... Tsc2-/- Subcutaneous Tumor Data (Vincristine, Asparaginase, Sunitinib, and Bevacizumab) Untreated Rapamycin Vincristine Combination Vincristine plus Rapamycin Asparaginase Combination Asparagin...

Ngày tải lên: 18/06/2014, 16:20

18 612 0
Báo cáo hóa học: "Expression of Msx-1 is suppressed in bisphosphonate associated osteonecrosis related jaw tissue-etiopathology considerations respecting jaw developmental biology-related unique features" docx

Báo cáo hóa học: "Expression of Msx-1 is suppressed in bisphosphonate associated osteonecrosis related jaw tissue-etiopathology considerations respecting jaw developmental biology-related unique features" docx

... using Fast Red solution, and localized by biotin- ass ociated activation of the staining kit (ChemMate-Kit, Dako) followed by incubation in hematoxylin for nuclear counterstaining. Two consecutive ... substantiate clinical findings of BP-related impaired remodeling specific to periodontal tissue. RANKL suppression substantiated the clinical finding of impaired bone remodelling in BP...

Ngày tải lên: 18/06/2014, 16:20

9 465 0
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx

Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx

... 5’-CCTGAAATGAA- GAAACTACACCAGGGC-fluorescein and 5’-L C- Red 640-GCTATATCAGAGCAACCCCAACCAGC- phosphate. Real-time PCR monitoring was achieved by measuring the fluorescence signal at the end of annealing phase of each cycle. ... 8:107 http://www.translational-medicine.com/content/8/1/107 Page 5 of 8 Cell lines To prepare for CEA-specific RT-PCR, two cell lines, SW-480 (colon cancer cell...

Ngày tải lên: 18/06/2014, 16:20

8 439 0
Báo cáo hóa học: "Evaluation of six CTLA-4 polymorphisms in highrisk melanoma patients receiving adjuvant interferon therapy in the He13A/98 multicenter trial" docx

Báo cáo hóa học: "Evaluation of six CTLA-4 polymorphisms in highrisk melanoma patients receiving adjuvant interferon therapy in the He13A/98 multicenter trial" docx

... 7 of 9 forward ACCCTTGTACTCCAGGAAATTCTC, reverse biotinylated-GGTTTAGCTGTTACGTCGAAAAGA, AG 49 forward TTTCAGCGGCACAAGGCTC, reverse biotinylated-GAGTGCAGGGCCAGGTCC, CT 60 for- ward GCAAGTCATTCTTGGAAGGTATC, ... software. The sequencing primers used were: 31 8C/ T CACTTAGTTATCCA- GATCCT, AG 49 GCTCAGCTGAACCTG, CT 60 TCA CCACTATTTGGGATAT, JO 27 TACCAGAAGTT GAAGTGTAG, JO 30 TCTGTCAGCAAAGCC, and...

Ngày tải lên: 18/06/2014, 16:20

9 517 0
w