Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF9 of A. thaliana.These proteins b elong to the 2Cys-Prx subfamily. A ll plan t2Cys-Prx proteins, except BAS1 of barley, ... were separated by HPLC and some of themwere totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2).Computer database searches based on the amino-acidsequences ... MareÂchal, P.,Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thalianaNADPH thioredoxin reductase: cDNA characterization and expression of the r e combinant protein in Escherichia...
- 11
- 608
- 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx
... Isolation and characterization of a D-cysteinedesulfhydrase protein from Arabidopsis thalianaAnja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and Jutta PapenbrockInstitute for Botany, ... Ohkishi H, Kawakami B, Yamano H,Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala-nine chloride-lyase (deaminating) of Pseudomonas putidaCR 1–1. Purification and characterization of a novelenzyme ... ground wasused for the analyses. (A) Total RNA was extracted and 20 lg RNAwas loaded in each lane and blotted as indicated in Experimentalprocedures. To prove equal loading of the extracted RNA...
- 14
- 565
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... 5907Synthesis and characterization of a new and radiolabeledhigh-affinity substrate for H+/peptide cotransportersIlka Knu¨tter1, Bianka Hartrodt2,Ge´za To´th3, Attila Keresztes3, Gabor ... was inhibited not only byunlabeled Bip-Pro itself, but also by well known sub-strates of H+⁄ peptide cotransporters, such as Gly-Sar,Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala,d-aminolevulinic ... after radioactive labeling we determined thekinetic parameters and transport characteristics of Bip-[3H]Pro.Results and DiscussionSynthesis, chemical characterization and stability of Bip-ProFigure...
- 10
- 490
- 0
báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot
... functioning, and a significant increase of physical and role functioning and global health (table 7).The above mentioned results point towards a relevant cor-relation with quality of life and a scale ... the demographic, table 2 the clinical and treatment characteristics of the participants. Participantswith malignancies had a broad range of tumour localisa-tions (table 3). At the time of being ... 1.8Leiomyosarcoma 1 1.8Melanoma 1 1.8Ovarian carcinoma 2 3.5Ovarian sarcoma 1 1.8Pancreatic cancer 2 3.5Pharyngeal cancer 1 1.8Plasmocytoma 4 7.0Pleural mesotelioma 3 5.3Prostatic cancer 3...
- 11
- 622
- 0
báo cáo hóa học: "Validity and reliability of a new, short symptom rating scale in patients with persistent atrial fibrillation" pot
... co-morbidities and about their medical and specific arrhyth-mia history. A 12-lead electrocardiogram and an echocar-diography were performed. The study was carried out as a part of the quality assurance ... satisfactory reliability and validity.BackgroundTo date there are few disease-specific instruments thatassess symptoms of atrial fibrillation (AF), and theyappear to be largely unvalidated and/ or ... state, depression, worry and anxiety seem to playimportant roles and may affect the relapse rate of AF aswell as the symptomatology and the quality of life[26,27]. 'Anxiety due to AF'...
- 10
- 497
- 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereasagglutination was inhibited by galactose and its deriva-tives [such as N-acetylgalactosamine (GalNAc),methyl -a- d-galactopyranoside], it was evident that, atdoses ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts tocleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing...
- 12
- 763
- 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... (Forward: 5¢-ACAAGGGTAGACCAAACACCAAGAACAGCAACAAAAGAGACGGGCGAATCACTGACCATCAACgccGTCCTGAGAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAATGCGGTGCCAGCTCCCCAACTGTAATAAATACCAGACAAATTATATGCTCCaacCCTATACGTGCCACTG-3¢); ... linker and dual FLAG octa-peptide tags). Approximate elution times for a series of proteinstandards are indicated by arrows, and the absorbance at A 214(unbroken line) and A 280(dashed line) ... TRVDQTP…5¢ Amplification 8407 (fi)GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC N-terminus ¼ ARVDQTP…5¢ Amplification 8408 (fi)GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC N-terminus ¼ AWVDQTP…3¢ Amplification...
- 12
- 522
- 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot
... nodec–+dND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢.bPrimer pair: 5¢-GCCATTTTAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢.cPrimer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ ... product of 513 bp containing the transmembrane domain: 5¢-CATCCATAGCAGATAACAGTC-3¢ (forward) and 5¢-TCCCAAAGCTCATGTCATAAG-3¢ (reverse) corresponding toamino-acid residues S(123)SIADNSL(130) and ... Rasmussen, ParisaMabhout and Marian Dyrberg Andersen for technical assistance,Arla Innovation Centre, Brabrand, Denmark, for supplying thebovine milk samples, and Department of Pediatrics, AarhusUniversity...
- 9
- 614
- 0
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt
... anessential component of the TGF-b signaling pathway. In thisstudy, we describe the isolation of Xenopus HIVEP1,aswellas partial cDNAs of HIVEP2 and -3. Analysis of the tem-poral and spatial expression ... HIVEP1,hasalso been isolated and characterized [14–16].Typically, the large zinc finger (Znf) DNA bindingproteins have a molecular mass greater than 250 kDa and contain two ZAS domains (N and C) ... late gastrula and neurula stages (stages 11–20), expression decreases temporarily and increases again atstage 24. In adult tissue, XHIVEP transcripts were detectedat comparable levels in all...
- 10
- 414
- 0
báo cáo hóa học:" Isolation and culture of fibroblasts from endoscopic duodenal biopsies of celiac patients" pdf
... expressed as mean ± standard deviation (SD) ormedian and range. A comparison of the morphometricdata obtained from culture of CD and non-CD subjectswas done using one way ANOVA. All statistical analysiswas ... morpho-metric evaluation included the major orthogonaldiameters and their ratio, as index of circularity, theperimeter, the area, and their ratio, as index of complexity.Statistical analysisData were ... 5Cardiothoracic Department, Institute of Cardiovascular Medicine, Center of Clinical Physiology and Hypertension, Laboratory of Clinical Informatics and Cardiovascular Imaging, University of Milan, ItalyEmail:...
- 8
- 563
- 1
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa họcbáo cáo y họcbáo cáo môn họcbáo cáo triết họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)