Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

... protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, except BAS1 of barley, ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches ba...

Ngày tải lên: 08/03/2014, 16:20

... Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana Anja Riemenschneider, Rosalina Wegele, Ahlert Schmidt and Jutta Papenbrock Institute for Botany, ... Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and characterizati...

Ngày tải lên: 16/03/2014, 18:20

... 5907 Synthesis and characterization of a new and radiolabeled high-affinity substrate for H + /peptide cotransporters Ilka Knu ¨ tter 1 , Bianka Hartrodt 2 ,Ge ´ za To ´ th 3 , Attila Keresztes 3 , Gabor ... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala...

Ngày tải lên: 07/03/2014, 05:20

... functioning, and a significant increase of physical and role functioning and global health (table 7). The above mentioned results point towards a relevant cor- relation with quality of life and a scale ... the demographic, table 2 the clinical and treatment characteristics of the participants. Participants with malignancies had a broad range of tumour localisa- tions...

Ngày tải lên: 18/06/2014, 18:20

... co- morbidities and about their medical and specific arrhyth- mia history. A 12-lead electrocardiogram and an echocar- diography were performed. The study was carried out as a part of the quality assurance ... satisfactory reliability and validity. Background To date there are few disease-specific instruments that assess symptoms of atrial fibrillation (AF), and they appear...

Ngày tải lên: 18/06/2014, 18:20

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereas agglutination was inhibited by galactose and its deriva- tives [such as N-acetylgalactosamine (GalNAc), methyl -a- d-galactopyranoside], it was evident...

Ngày tải lên: 18/02/2014, 16:20

... (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); ... linker and dual FLAG octa- peptide tags). Approximate elution times for a series of protein standards are indicated by arrows, and the absorbance at A 214 (unbroken l...

Ngày tải lên: 17/03/2014, 10:20

... node c –+ d ND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢. c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ ... product of 513 bp containing the transmembrane domain: 5¢-CATCC ATAGCAGATAACAGTC-3¢ (forward) and 5¢-TCCCA AAGCTCATGTCATAAG-3¢ (reverse) corresponding to amino-acid r...

Ngày tải lên: 24/03/2014, 04:21

... an essential component of the TGF-b signaling pathway. In this study, we describe the isolation of Xenopus HIVEP1,aswell as partial cDNAs of HIVEP2 and -3. Analysis of the tem- poral and spatial expression ... HIVEP1,has also been isolated and characterized [14–16]. Typically, the large zinc finger (Znf) DNA binding proteins have a molecular mass greater than 250 kDa and co...

Ngày tải lên: 30/03/2014, 13:20

... expressed as mean ± standard deviation (SD) or median and range. A comparison of the morphometric data obtained from culture of CD and non-CD subjects was done using one way ANOVA. All statistical analysis was ... morpho- metric evaluation included the major orthogonal diameters and their ratio, as index of circularity, the perimeter, the area, and their ratio, as index of c...

Ngày tải lên: 18/06/2014, 15:20