Báo cáo hóa học: " Nucleotide mismatches between the VP7 gen

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Corresponding author Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures ... strains from databases we found that 74 (61.2 %) out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' e...

Ngày tải lên : 20/06/2014, 01:20

4 329 0

báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx

... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA ... UV-light. Nucleotide mismatches in the primersFigure 2 Nucleotide mismatches in the primers. The target sequence is the VP7 gene o...

Ngày tải lên : 20/06/2014, 04:20

5 355 0

Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf

... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed ... sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed Central Page 1 of 5 (page number not for citation purposes) Virology Journal Open A...

Ngày tải lên : 19/06/2014, 08:20

5 389 0

Báo cáo hóa học: " Some like it hot: environmental determinism and the pastoral economies of the later prehistoric Eurasian steppe" docx

... example, Petropavlovsk in the north of K azakhstan has an average yearly temperature of 1.5°C and an average precipitation of 366 mm, and desert land on the Syr-Darya in the south of Kazakhstan has an average ... semi-deserts and deserts of Central Asia and the Black and Caspian Seas, with the further vegetation zone of alpine and mountain pastures of th...

Ngày tải lên : 21/06/2014, 03:20

16 279 0

báo cáo hóa học:" Research Article On Some Geometric Constants and the Fixed Point Property for Multivalued Nonexpansive Mappings" pot

... η. 3.12 Hence, the inequality C Z   X ≤ C Z X follows from the arbitrariness of η. 10 Fixed Point Theory and Applications The characteristic of noncompact convexity of X associated with the measure of noncompactness ... Multivalued Nonexpansive Mappings Jingxin Zhang 1 and Yunan Cui 2 1 Department of Mathematics, Harbin Institute of Technology, Harbin 1500...

Ngày tải lên : 21/06/2014, 11:20

12 460 0

Báo cáo hóa học: " Research Article An ML-Based Estimate and the Cramer-Rao Bound for Data-Aided Channel Estimation in KSP-OFDM" pdf

... guard interval are added to the ﬁrst ν samples from the data part of the received signal, and then the N samples from the data part are applied to an FFT, while the guard interval samples are not transformed. ... the data part of the received signal are transformed to the frequency domain by an FFT, and the guard interval samples are not transformed....

Ngày tải lên : 22/06/2014, 19:20

9 283 0

Báo cáo hóa học: " Research Article Multivariate Twisted p-Adic q-Integral on Zp Associated with Twisted q-Bernoulli Polynomials and Numbers" pdf

... polynomials and numbers are called the twisted Bernoulli polynomials and numbers, respectively. When k  1,q  1, and ζ  1, the polynomials and numbers are called the ordinary Bernoulli polynomials ... β k n,ζ,q 0 are called the twisted q-Bernoulli numbers of order k. When k  1, the polynomials and numbers are called the twisted q-Bernoulli polynomials and...

Ngày tải lên : 21/06/2014, 07:20

6 181 0

báo cáo hóa học:" No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients" potx

... cancer stroma. The mast cell count in the nor- mal mucosa adjacent to the colon cancer was associated with the TNM classification characteristics and hepatic metastases, although it was not a prognostic ... metastasis (MCC slnm )and in the lymph tissue adjacent to the metastasis (MCC alnm ). Although MCC alnm was higher in papillary and tubular adenoma s than in mucoid...

Ngày tải lên : 20/06/2014, 03:20

6 360 0

báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

... ACTTCAGCGAGACCG-3'; ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTB forward: 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi- tions ... the experimental procedures and in the interpretation of the data, SXW, XL, TFL and WBX gave advises on the work and helped in the interpretation of the data, KTY superv...

Ngày tải lên : 18/06/2014, 15:20

9 509 0

báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx

... ICAM-1 and VCAM-1 predict pre- clinical cancer. Eur J Cancer 2005, 41:2355-9. 19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N, Orita K: ICAM-1 expression and the soluble ICAM-1 ... Jaureguibeitia 1 , Aritz Lopategi 2 , Iñigo Martínez 1 , Lorea Mendoza 1 , Francisco J Muruzabal 1 , Clarisa Salado 1 and Fernando Vidal-Vanaclocha* 2,3 Address: 1 Pharmakine Ltd., Biz...

Ngày tải lên : 18/06/2014, 15:20

12 419 0