Báo cáo hóa học: " Predicting the subcellular localization of viral proteins within a mammalian host cell" doc
Báo cáo Y học: Ontogeny and subcellular localization of rat liver mitochondrial branched chain amino-acid aminotransferase docx
... BCATm plays an important role in the reamination of branched chain 2-oxo acids because of anincrease in the concentration of glutamate in fetal liver at the end of pregnancy [29]. These data agree ... existence of anactive and inactive form of the BCAT, and the develop-mental changes in BCAT activity in rat liver coincided with the appearance and disappearance of the 41-kDa BCATm(Fig. 1B).BCATm ... and297–317 of rat heart BCATm cDNA, respectively. The external and nested gene specific forward primers for the 30RACE amplification were: 50-CAGAAGGAGTTGAAGGCTATT-30and 50-ACGGAACCAGTGCCCACGATT-30cor-responding...
- 8
- 301
- 0
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx
... (or Wilcoxon rank-sum test), the analysis of variance (ANOVA) test (orKruskal-Wallis test), and the Spearman-rank correlationcoefficient, as appropriate. For the analysis of histopatho-logic ... oversaw its design and coordination, supervised the analysis and interpretation of the data, and writing the manuscript. All authors read and approved the final man-uscript.Acknowledgements The ... primary patients. In fact, IGFBP-3 sera levels of the majority of the melanoma patients fell within the nor-mal expected range for adults. Interestingly, these dataalso contrast with what has...
- 9
- 486
- 0
Báo cáo hóa học: " Targeting the inflammation in HCV-associated hepatocellular carcinoma: a role in the prevention and treatment" pptx
... increased levels of aspartate transaminase, alanine transaminase, alkalinephosphatase, acid phosphatase, lactate dehydrogenase,gamma-glutamyltran sferase, 5’-nucleotidase, bilirubin,alpha-fetoprotein, ... Gastroenterol Hepatol2006, 21(12):1821-5.63. Mahmood S, Kawanaka M, Kamei A, Izumi A, Nakata K, Niiyama G, Ikeda H,Hanano S, Suehiro M, Togawa K, Yamada G: Immunohistochemicalevaluation of ... 124(11):2520-7.90. Jagan S, Ramakrishnan G, Anandakumar P, Kamaraj S, Devaki T:Antiproliferative potential of gallic acid against diethylnitrosamine-induced rat hepatocellular carcinoma. Mol Cell Biochem...
- 11
- 649
- 0
báo cáo hóa học: " Assessing the empirical validity of alternative multi-attribute utility measures in the maternity context" potx
... the trial if they were aged 17 years or over and had given birthto a live baby. The population living in the catchmentareas of the teaching hospital broadly reflected the ageand ethnic profile ... EQ-5Dutility score was less than 1.0. The empirical validity of the EQ-5D and SF-6D utilityscores was examined in a number of ways. One-way anal-ysis of variance was used to test the hypothetically-con-structed ... drafting the paper. JMand HS were the principal clinical investigators for the original postnatal support workers trial and contributedto iterative drafts of the paper.Additional materialAcknowledgementsWe...
- 12
- 329
- 0
báo cáo hóa học: " Measuring the ICF components of impairment, activity limitation and participation restriction: an item analysis using classical test theory and item response theory" potx
... contributed to the interpretation of the data andrevision of the manuscript. All authors read and approved the final manuscript.Histogram of Ab-PFigure 7Histogram of Ab-P.Health and Quality of Life ... design of the study, the analysis and the drafting and revision of the manu-script. MJ participated in the conception and design of the study and the drafting and revision of the manuscript. PDand ... uncontami-nated items from the combination of both analyses arereferred to as the AberdeenIAP measures (Ab-IAP) comprising Ab-I, Ab -A and Ab-P. The results for the CTT and IRT analysis are initiallyreported...
- 20
- 557
- 0
báo cáo hóa học: " On the potential role of glutamate transport in mental fatigue" ppt
... system. FASEB J 2003, 17:341-348.37. Tozaki H, Kanno T, Nomura T, Kondoh T, Kodama N, Saito N,Aihara H, Nagata T, Matsumoto S, Ohta K, Nagai K, Yajima Y,Nishizaki T: Role of glial glutamate transporters ... ratio) at normal glutamate neurotransmis-sion [12] and also, to avoid excitotoxic actions of gluta-mate on neurons. The clearance of glutamate from the extracellular space is achieved by high-affinity, ... evaluated with regard totheir effects on astroglial support of glutamate transmis-sion, and especially glutamate transport capacity. The role of the intact astroglial network in higher brain...
- 9
- 562
- 0
báo cáo hóa học: " Comparing the immunosuppressive potency of naïve marrow stromal cells and Notch-transfected marrow stromal cells" docx
... assay (forward primer: TTGGTC TTACT-GACATCCACTTTG, reverse primer CAGACACTTTGAAGCCCTCAG, exo-NICD-specific probe [6-FAM]CCCAGTTCAATTACAGCTCTTAAGGCTAGAG[BHQ 1a- 6FAM])). Amplification signals were ... designed the study, performed immunoassays andflow cytometry, analyzed and interpreted data, and wrote the manuscript .CCT partici pated in data analysis and interpretation, performed statisticalanalysis, ... 25:2025-32.33. Park SJ, Nakagawa T, Kitamura H, Atsumi T, Kamimura D, Park SJ,Murakami M, Kitamura Y, Iwakura Y, Hirano T: IL-6 regulates in vivodendritic cell differentiation through STAT3 activation....
- 14
- 408
- 0
Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx
... formulated a hypo-thesis that describes an integrated vision of the catalyticmechanism of both enzymes. The main points are: (a) a re-evaluation of the role of superoxide as a reductant in the catalytic ... highlights the presence of mutual chemical interactions between enzyme intermedi-ates and provides and explanation for catalase activity.Other questions, such as the localization of the aminoacid radical ... competition of catalase- vs. peroxidase-activity is weaker than in MPO and shifts all catalyticequilibria towards accumulation of Cpd II rather thennative LPO. This should also explain the higher...
- 10
- 529
- 0
Báo cáo hóa học: "Multicenter phase II study of matured dendritic cells pulsed with melanoma cell line lysates in patients with advanced melanoma" potx
... mross@mdanderson.org1University of California Los Angeles (UCLA), CA, USA2MD Anderson Cancer Center, Houston, TX, USAFull list of author information is available at the end of the articleRibas et al. Journal of Translational ... response of SD; the therapy resulted in a significantarrest of growth of the lung metastasis. The patientunderwent surgical resection of all active sites of diseaseat 13 months after initiating vaccine ... progressionbefore the start of treatment and two because of unsuc-cessful vaccine manufacture (Table 2). All patients hadRibas et al. Journal of Translational Medicine 2010, 8:89http://www.translational-medicine.com/content/8/1/89Page...
- 11
- 459
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP