Báo cáo hóa học: " Predicting the subcellular localization of viral proteins within a mammalian host cell" doc

... BCATm plays an important role in the reamination of branched chain 2-oxo acids because of an increase in the concentration of glutamate in fetal liver at the end of pregnancy [29]. These data agree ... existence of an active and inactive form of the BCAT, and the develop- mental changes in BCAT activity in rat liver coincided with the appearance and disappearance of...

Ngày tải lên: 31/03/2014, 23:20

... (or Wilcoxon rank- sum test), the analysis of variance (ANOVA) test (or Kruskal-Wallis test), and the Spearman-rank correlation coefficient, as appropriate. For the analysis of histopatho- logic ... oversaw its design and coordination, supervised the analysis and interpretation of the data, and writing the manuscript. All authors read and approved the final man- uscript. A...

Ngày tải lên: 18/06/2014, 15:20

Ngày tải lên: 18/06/2014, 16:20

... increased levels of aspartate transaminase, alanine transaminase, alkaline phosphatase, acid phosphatase, lactate dehydrogenase, gamma-glutamyltran sferase, 5’-nucleotidase, bilirubin, alpha-fetoprotein, ... Gastroenterol Hepatol 2006, 21(12):1821-5. 63. Mahmood S, Kawanaka M, Kamei A, Izumi A, Nakata K, Niiyama G, Ikeda H, Hanano S, Suehiro M, Togawa K, Yamada G: Immunohistochemical eval...

Ngày tải lên: 18/06/2014, 16:20

... the trial if they were aged 17 years or over and had given birth to a live baby. The population living in the catchment areas of the teaching hospital broadly reflected the age and ethnic profile ... EQ-5D utility score was less than 1.0. The empirical validity of the EQ-5D and SF-6D utility scores was examined in a number of ways. One-way anal- ysis of variance was...

Ngày tải lên: 18/06/2014, 18:20

... contributed to the interpretation of the data and revision of the manuscript. All authors read and approved the final manuscript. Histogram of Ab-PFigure 7 Histogram of Ab-P. Health and Quality of Life ... design of the study, the analysis and the drafting and revision of the manu- script. MJ participated in the conception and design of the study and the...

Ngày tải lên: 18/06/2014, 18:20

... system. FASEB J 2003, 17:341-348. 37. Tozaki H, Kanno T, Nomura T, Kondoh T, Kodama N, Saito N, Aihara H, Nagata T, Matsumoto S, Ohta K, Nagai K, Yajima Y, Nishizaki T: Role of glial glutamate transporters ... ratio) at normal glutamate neurotransmis- sion [12] and also, to avoid excitotoxic actions of gluta- mate on neurons. The clearance of glutamate from the extracellular space i...

Ngày tải lên: 19/06/2014, 22:20

... assay (forward primer: TTGGTC TTACT- GACATCCACTTTG, reverse primer CAGACACTT TGAAGCCCTCAG, exo-NICD-specific probe [6-FAM] CCCAGTTCAATTACAGCTCTTAAGGCTAGAG [BHQ 1a- 6FAM])). Amplification signals were ... designed the study, performed immunoassays and flow cytometry, analyzed and interpreted data, and wrote the manuscript . CCT partici pated in data analysis and interpretation, performed s...

Ngày tải lên: 19/06/2014, 22:20

... formulated a hypo- thesis that describes an integrated vision of the catalytic mechanism of both enzymes. The main points are: (a) a re-evaluation of the role of superoxide as a reductant in the catalytic ... highlights the presence of mutual chemical interactions between enzyme intermedi- ates and provides and explanation for catalase activity. Other questions, such...

Ngày tải lên: 20/02/2014, 02:21

... mross@mdanderson.org 1 University of California Los Angeles (UCLA), CA, USA 2 MD Anderson Cancer Center, Houston, TX, USA Full list of author information is available at the end of the article Ribas et al. Journal of Translational ... response of SD; the therapy resulted in a significant arrest of growth of the lung metastasis. The patient underwent surgical resectio...

Ngày tải lên: 18/06/2014, 16:20