Báo cáo hóa học: " Neutralizing human monoclonal antibody against H5N1 influenza HA selected from a Fab-phage display library" pptx
Báo cáo hóa học: " Neutralizing human monoclonal antibody against H5N1 influenza HA selected from a Fab-phage display library" pptx
... humanized protective antibody VN04-2 was used as a positive control. A. % Control Antibody (2ug/ml) 0 20 40 60 80 100 120 No Ab VN04- 2 HA 1 HA 3 HA 4 HA 5 HA 6 HA 7 HA 8 HA 10 HA 11 HA 12 HA ... Central Page 1 of 10 (page number not for citation purposes) Virology Journal Open Access Research Neutralizing human monoclonal antibody against H5N1 infl...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" HIV/AIDS-Related Knowledge Among Malaysian Young Adults: Findings From a Nationwide Survey" pdf
... Musang MALAYSIA BORNEO BRUNEI Kota Kinabalu Kuching MALAYSIA Tioman NN INDONESIA (Kalimantan) Kotabalu National Park Kuantan Seremban NEGERI SEMBILAN Kota Kinabalu SABAH MALAYSIA SULU SEA Gombak Batu Pahat SARAWAK Miri Kuching MELAKA PAHANG Cameron Highlands TERENGGANU Kota ... Pahat SARAWAK Miri Kuching MELAKA PAHANG Cameron Highlands TERENGGANU Kota Bahru Alur Setar Kangar KELANTAN PERAK Ip...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... software were as follow: ABCC2 forward: 5'-CTC ACTTCAGCGAGACCG-3'; ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTB forward: 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA ... data showed that intracellular accumulation of cisplatin in CNE2 cells with decreased expression of ABCC2 was more than that in parent CNE2 cells, which indicated that ABCC2 protein has t...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Perfused human organs versus Mary Shelley''''s " ppt
... Overall, use of ex vivo human organs in drug trials can generate useful human data in order to fast-track a trial drug for more advanced clinical Published: 23 January 2009 Journal of Translational ... organs allow a three dimensional biologi- cal system with a certain degree of retained physiological functions, native cellular architecture, and extracellular matrix that are superio...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Increased human defensine levels hint at an inflammatory etiology of bisphosphonateassociated osteonecrosis of the jaw: An immunohistological study" docx
... metastatic prostate canc er, 8 patients had breast cancer and 6 patients had plasmocytoma. 13 patients received IV zoledronate and 6 pat ients pami- dronate and 1 patient received ibandronate after zole- dronic ... a patient who was receiving or had been exposed to a bispho- sphonate and had not had radiation therapy to the craniofacial region [15,16]. 6 patients in the BONJ group suf fer...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Permissive human cytomegalovirus infection of a first trimester extravillous cytotrophoblast cell line" ppt
... microvascu- lar endothelial cells to differentiating/invasive placental cytotrophoblasts. Virology 2002, 304:53-69. 9. Terauchi M, Koi H, Hayano C, Toyama-Sorimachi N, Karasuyama H, Yamanashi Y, Aso ... USA and 2 Department of Microbiology and Immunology, Tulane University Health Sciences Center, New Orleans, LA, USA Email: Heather L LaMarca - hlamarc@tulane.edu; Bruno Sainz - bsainz@tulane....
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5'- TCGTTCCCAATCCCAAGGTA-3'. The rat GAPDH tran- script was measured for each sample to normalize the amount of input RNA ... Software (Applied Biosys- tems, Foster City, CA). The ABCG1 probe, FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTA...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc
... regimens following allograft transplantation. The large pharmacokinetic (PK) and pharmacodynamic (PD) variability and narrow therapeutic range of MPA provide a potential for therapeutic drug monitoring. ... Hoitsma A, Squifflet JP, Weimar W, Vanrenterghem Y, Woude FJ Van de, Verpooten GA: The pharmacokinetic-pharmacodynamic relationship for mycophenolate mofetil in renal transplantation. C...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Translating molecular medicine into clinical tools: doomed to fail by neglecting basic preanalytical principles" pptx
... matrix metalloproteinase-9 in human plasma. Anal Biochem 2003, 322:283-286. 17. Mannello F, Luchetti F, Canonico B, Papa S: Effect of anticoagu- lants and cell separation media as preanalytical ... for a reasonably feasible extrapolation from serum to plasma data would be based on strong cor- relations between serum and plasma values and equal ratios of serum to plasma values in control...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... M, Bjorling E, Agaton C, Szigyarto CA, Amini B, Andersen E, Andersson AC, Angelidou P, Asplund A, Asplund C, et al: A human protein atlas for normal and cancer tissues based on antibody proteomics. ... Battista T, De Luca A, Santini D, Rossiello L, Baldi F, Natali PG, Lombardi D, Picardo M, Felsani A, Paggi MG: Identification of genes down- regulated during melanoma progression: a...
Ngày tải lên: 18/06/2014, 16:20