Báo cáo hóa học: " Respiratory syncytial virus glycoproteins uptake occurs through clathrin-mediated endocytosis in a human epithelial cell line" docx

... BR, Sidhu MS: Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evalua- tion and molecular characterization of a cold-passaged, attenuated ... this uptake pathway blocks RSV infection, demon- strating an important role of clathrin for RSV entry [9]. Proteins that are internalized through the clathrin-medi- ated pathway...

Ngày tải lên: 20/06/2014, 01:20

... B, Rabin RL, Collins PL: Suppression of the induction of alpha, beta, and lambda interferons by the NS1 and NS2 proteins of human respiratory syncytial virus in human epithelial cells and macrophages ... Jamie Barber - barber@uga.edu; Ralph A Tripp* - ratripp@uga.edu * Corresponding author Abstract Respiratory syncytial virus (RSV) is a major cause of severe lower air...

Ngày tải lên: 20/06/2014, 01:20

... internalization of RSV Ag-Abs Our results showed that anti-RSV IgG incubation induced the removal and re-appearance of intracellular viral pro- Confocal laser scanning image of intracellular ... Journal Open Access Research Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line Rosa E Sarmiento, Rocio G Tirado, Laura E...

Ngày tải lên: 18/06/2014, 18:20

... Journal Open Access Research Kinetics of antibody-induced modulation of respiratory syncytial virus antigens in a human epithelial cell line Rosa E Sarmiento, Rocio G Tirado, Laura E Valverde and ... [6]. During consecutive assays, cell- surface- and intracellular- protein concentrations fluctuated in a cyclic manner, thus suggesting a continued removal and replacement...

Ngày tải lên: 20/06/2014, 01:20

... RSV infection, data analyses; AM BAL, formalin fixation, plethysmography; AMG histopathol- ogy and special staining; KDO real-time PCR; AMR and MFA plethysmography and BAL; OR data interpretation; HSJ ... Tekkanat KK, Maassab H, Berlin AA, Lincoln PM, Evanoff HL, Kaplan MH, Lukacs NW: Role of interleukin-12 and stat-4 in the regu- lation of airway inflammation and hyperreactivity in respi...

Ngày tải lên: 19/06/2014, 08:20

... the analytical capabilities of typical water testing laboratories. Adenovirus has been proposed as an indica- tor because of its remarkable resistance characteristics and lack of seasonal variability. ... H, Tajima A, Naka- jima H, Ohgaki S: Seasonal profiles of human noroviruses and indicator bacteria in a wastewater treatment plant in Tokyo, Japan. Water Sci Technol 2006, 54:301-30...

Ngày tải lên: 20/06/2014, 01:20

... 5'- AAGGGGGGATCCACCATG GCGCCCATCACGGCG- TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAACCCG-3' ... 5'- GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3' and 5'- CCCGGTACCGTCTGTGTCACAGAGAGAAAGGGAG-3' (for IFN-λ3 promoter),...

Ngày tải lên: 20/06/2014, 01:20

... of age (2 ani- mals of groups 3 and 4 each; table 1). The remaining eight vaccinated SIVmac251-5/98-infected infants, including all four SIVmac 1A1 1-vaccinated animals, were clinically stable at ... SIVmac251-5/98-infected infant macaquesFigure 4 Evolution of plasma variants in SIVmac251-5/98-infected infant macaques. HMA analysis was performed on sequen- tial plasma RNA samples, and each...

Ngày tải lên: 20/06/2014, 04:20

... sites respectively as follows: 5'-GAGGATCCTCAAAGATAA- GAGGAGGATCGT-3' and 5'-GAGATATCTCG- GGGGCCAGGTCCAAGCAGA-3' HBV DNA (adw2 subtype) was used as template for PCR to amplify the ... noted. Confirmation of Interaction by Mammalian CheckMate System The partial human guanine nucleotide binding protein β subunit 5L (GNβ5) insert was amplified for cloning in- frame with...

Ngày tải lên: 20/06/2014, 04:20