Báo cáo hóa học: " A comparative analysis of viral matrix proteins using disorder predictors" docx
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"
... Publisher. All rights reserved Research paper A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections ... commercially available PG and TA 3.6 Correlation coefficients We analyzed the correlation of levels of anti- peptidoglycan and teichoic acid antibodies in sera from patients with deep-seated and ... of antistaphylococcal IgG antibodies. Antibodies against S. aureus cell wall antigen peptidoglycan (A) and teichoic acid (B) were measured ELISA in sera (1:1000) from helathy individuals and...
- 8
- 524
- 2
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... phase contrast and fluorescence photo-graphs of selected field of cells obtained under the samemagnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline ... prepared as described above for flowcytometry. After establishing a scan area, the slides wereanalyzed using a 40 · objective and 5 mW of Argon laserpower. The entire cell preparation was examined. ... theantiproliferative capacity of WP631 (measured as IC50after a 72-h continuous treatment) was greater than that of daunorubicin. The propensities of daunorubicin and WP631to promote apoptosis...
- 7
- 581
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... deoxyribonuclease (DNase I, amplification grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis sys-tem (Agilent Technologies, ... This analysis of microarray data revealed a striking similar-ity of gene clusters among AT-MSC-Hepa, primaryhepatocytes and human liver. This indicates thatAT-MSC-Hepa are similar to human hepatocytes ... 425–438.33 Hatada I, Fukasawa M, Kimura M, Morita S, Ya-mada K, Yoshikawa T, Yamanaka S, Endo C, Saku-rada A, Sato M et al. (2006) Genome-wide profiling of promoter methylation in human. Oncogene...
- 14
- 597
- 0
báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx
... Thus, a hand trajectory that followed a straight line pathway tothe target would have an HPR equal to 1, whereas a handtrajectory that travelled twice as far as needed would have a HPR of 2.Subsequently, ... effects of therapy for rehabilitation practiceis important both for rehabilitation personal and patients.Characterizing the features of reaching and quantifyingspecific variables allows therapists ... the right hand.Data analysis Kinematic data sampling and information processingHand position data (haptic stylus end-point) were gath-ered during each trial. The x-, y- and z-coordinates, whichwere...
- 8
- 551
- 0
báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx
... for all features were also calculatedwith ROC areas. All data analyses were performed off-line, using custom software programs written for MATLAB (TheMathworks, Natick, MA).Surrogate data analysis To ... investigated in a larger and more diversesample of healthy and falls risk elderly adults.Surrogate data analysis The use of surrogate data was aimed at destroying theunderlying control mechanism and ... subjects, managed data acquisition and par-ticipated to drafting of the manuscript. AHK and MP con-ceived the study, evaluated the data, performed dataanalyses and wrote the manuscript. All authors...
- 10
- 471
- 0
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx
... E-Mail: kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese ... zone, values of statistical measures such as type-token ratio, the parameters of 'laws' (e.g. of Mandel- brot, 1962) of word frequency distributions, etc. change systematically according ... frequencies and on related Marko- vian models of discourse." In: Jakobson, R. (ed.) Structure of Language and its Math- ematical Aspects. Rhode Island: American Mathematical Society....
- 7
- 594
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao*, Galen Andrew*, Mark Johnson*&, Kristina Toutanova* *Microsoft ... Introduction Parameter estimation is fundamental to many sta-tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... Lasso (L1) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of...
- 8
- 504
- 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx
... eztend/retraet can be analyzed as a modifier of cycle, a process word. Fuze setter, a part name, can be treated as a unit because noun sequences consisting of part names are generally local in nature. ... ). In addition, it can be a repair action (alignment, repair), an assistance actions ( assistance ), and so on. Only modifiers with appropriate semantic and syntactic category can be adjoined. ... the Oflace of Naval Research and the Ofllce of Naval Technology PE-62721N. The author gratefully acknowledges the efforts of Joan Bachenko, Judy Froseher, and Ralph Grishman in pro- ceasing...
- 4
- 515
- 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... (kid A5 5G)PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E)PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 ... D75N)PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change ATC–TTA in D75 (kid D75N)PR73H()) ACCACAGGTGTTGTACATTGCGATCAACC Change CGT–CAT in R73 (kid R73H)PR73H(+) GGTTGATCGCAATGTACAACACCTGTGGT Change ACG–ATG...
- 14
- 477
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
- 8
- 546
- 1
Từ khóa: a comparative analysis of different types of models in software development life cyclebáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ