Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC- CGGGTTTATTTCCTAAAAT GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG- GAAATGTTGAATACTCA TACTCTTCCTTTTTC-3'. The linear PCR-generated frag- ments were electroporated into YEbac102, ... pCR2 .1 (Invitrogen) using the follow- ing primers: 5'-AGGGCGGGGGCATCGGGCACCGGGAT- GGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC- GACAGCAAGCGAACCGGAAT-3...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
báo cáo hóa học:" Functional inaccessibility of quiescent herpes simplex virus genomes" pot

báo cáo hóa học:" Functional inaccessibility of quiescent herpes simplex virus genomes" pot

... EC: Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide Vmw 110 . J Gen Virol 19 86, 67:25 71- 2585. 5. ... Construction and characterization of herpes sim- plex virus type 1 mutants with defined lesions in immediate- early gene 1. J Gen Virol 19 89, 70 :11 85 -...

Ngày tải lên: 20/06/2014, 04:20

14 240 0
Báo cáo sinh học: " Functional inaccessibility of quiescent herpes simplex virus genomes" doc

Báo cáo sinh học: " Functional inaccessibility of quiescent herpes simplex virus genomes" doc

... this global barrier to the access of trans-acting factors. Background Herpes simplex virus (HSV) is a significant human patho- gen and the prototypical member of the herpesviridae, a large family of ... 19 95, 76 :14 17 -14 31. 21. Jackson SA, DeLuca NA: Relationship of herpes simplex virus genome configuration to productive and persistent infec- tions. Proc N...

Ngày tải lên: 19/06/2014, 08:20

14 267 0
báo cáo hóa học: " Reactive oxygen species drive herpes simplex virus (HSV)-1-induced proinflammatory cytokine production by murine microglia" ppt

báo cáo hóa học: " Reactive oxygen species drive herpes simplex virus (HSV)-1-induced proinflammatory cytokine production by murine microglia" ppt

... ATTTCCACGATTTCCCAGAG-3’ for IL-6; sense 5’ - AGGCTGGAGAGCTACAAGAGGA-3’ and anti- sense 5’ -GACCTTAGGGCAGATGCAGTTT-3’ for CCL2; sense 5’-GTCATTTTCTGCCTCATCCTGCT-3’ and antisense 5’-GGATTCAGACATCTCTGCTCATCA- 3’ ... culture supernatants for ELISA. Statistical analysis Data are expressed as mean ± SD or SEM as indicated. For comparison of means of multiple groups analysis of variance (ANOVA...

Ngày tải lên: 19/06/2014, 22:20

9 335 0
Báo cáo hóa học: " Correlation analysis of the speech multiscale product for the open quotient estimation" doc

Báo cáo hóa học: " Correlation analysis of the speech multiscale product for the open quotient estimation" doc

... a correlation analysis for the fundamental frequency and OQ measurement. The approach validation is done on voiced parts of the Keele University database by calcula ting the absolute and relative ... 2 011 , 2 011 :8 http://asmp.eurasipjournals.com/content/2 011 /1/ 8 Page 10 of 12 approximateintervalmorelittlethantheperiodto localise the GOI. Once the GOIs are accurately...

Ngày tải lên: 20/06/2014, 22:20

12 543 0
báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

... mitotic catastrophe after DNA damage. Nature 19 99, 4 01( 6753): 616 -620. 25. Osada H, Tatematsu Y, Yatabe Y, Nakagawa T, Konishi H, Harano T, Tezel E, Takada M, Takahashi T: Frequent and histological ... minutes and finally with 400 V for 60 minutes. After IE-focusing, the sample was added on the cathodic side of the tube gel. The aliquot of the sample contained a Table...

Ngày tải lên: 18/06/2014, 15:20

8 530 0
báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx

báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx

... signaling cascade involving the SMAD, a family of proteins similar to the gene products of the Drosophila gene "mothers against decapentaplegic" (Mad) and the C. elegans gene Sma. SMAD2 ... migration and invasion in mammary epithelial cells. Proceedings of the National Academy of Sciences of the United States of America 2004, 10 1 :12 57 -12 62. 49....

Ngày tải lên: 18/06/2014, 15:20

11 659 0
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx

báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx

... cells Paola Bontempo 1, 2 , Luigi Mita 1, 2,3 , Antonella Doto 1 , Marco Miceli 1 , Angela Nebbioso 1 , Ilaria Lepore 1 , GianLuigi Franci 1 , Roberta Menafra 1 , Vincenzo Carafa 1 , Mariarosaria ... Diano 2,3,6 , Marianna Portaccio 2,3 , Gustavo D Mita 3,4 , Maria Teresa Vietri 1 , Michele Cioffi 1 , Ernesto Nola 1 , Carmela Dell'Aversana 1 , Vincenzo Sica 1...

Ngày tải lên: 18/06/2014, 15:20

8 604 0
báo cáo hóa học:" Epigenetic control of the ubiquitin carboxyl terminal hydrolase 1 in renal cell carcinoma" doc

báo cáo hóa học:" Epigenetic control of the ubiquitin carboxyl terminal hydrolase 1 in renal cell carcinoma" doc

... amplification with a set of internal primers (sense: 5'- GGT TTT GTT TTT GTT TTT TTT GTA TAG GTT-3' and anti- sense: 5'-AAA AAC AAA TAC AAA AAA AAA AAC AAA ACC-3') using 1/ 5 th ... mix, 1. 5 mM MgCl 2 , 2 U Taq polymerase and 10 pmol of the primers 5'-GAG TTT TAG AGT AAT TGG GAT GGT GAA -A- 3' and 5'-CCA CTC ACT TTA TTC AAC ATC TAA AAA ACA-3&ap...

Ngày tải lên: 18/06/2014, 15:20

9 724 0
báo cáo hóa học:" Optical imaging of the peri-tumoral inflammatory response in breast cancer" docx

báo cáo hóa học:" Optical imaging of the peri-tumoral inflammatory response in breast cancer" docx

... wrote part of the manuscript. CA and VR gathered a portion of the in vitro data. FVC was the primary investigator on the T32 training grant and edited the manuscript. LMC was the primary investigator ... model of breast can- cer is a well characterized model which recapitulates human disease, with progression from hyperplasia to invasive carcinoma and metastatic diseas...

Ngày tải lên: 18/06/2014, 15:20

9 742 0
Từ khóa:
w