Báo cáo hóa học: " Complete genome sequence of a highly divergent astrovirus isolated from a child with acute diarrhea" ppt
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... the male and female respond- ents are displayed in Table 1. Mean age in the total sample was 59 ± 11 years, 54% were female, mean HbA 1c was 6.8 ± 1.8 and participants had a mean diabetes duration ... quality of the data collected and participated in the design of the validation study and the development of the statistical plan. FP carried out the statistical analyses. All authors pa...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Single-trial classification of motor imagery differing in task complexity: a functional near-infrared spectroscopy study" ppt
... average offline classification accuracy of 80% was achieved in 40% of the locked-in part icipa nts using maximum and mean Δ[O 2 Hb] as f ea- tures and a non-linear discriminant classifier. Tai ... single-trial classifications of fNIRS hemodynamic data included different combina- tions of mental tasks, signal features and classifiers. Sitaram et al. [4] performed offline classificati...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt
... 7, p 3 A3 ¢p5 A2 ¢p5 A; 8, p 3 A3 ¢p5 A3 ¢p5 A; 9, adenosine; 10, mixture of A2 ¢p5 A and A2 ¢p5 A2 ¢p5 A2 ¢p5 A; 11, mixture of A2 ¢p5 A2 ¢p5 A and A3 ¢p5 A2 ¢- p5 A( m ⁄ z 924.6); 12, A2 ¢p5 A3 ¢p5 A( m ⁄ z ... Poly(I)Æpoly(C), an efficient artificial activator of the mammalian 2- 5A synthetases, has only a minimal effect (an approximate two-fold increase) on the sponge rec...
Ngày tải lên: 23/03/2014, 09:20
báo cáo hóa học:" Anti-angiogenic effect of high doses of ascorbic acid" pptx
... concentrations of AA. In humans, these high-concentrations of AA can be achieved only by intravenous administration of AA. The pharma- cokinetics of high concentrations of AA has been summa- rized in research ... Gonzalez MJ, Miranda-Massari JR, Mora EM, Guzman A, Riordan NH, Riordan HD, Casciari JJ, Jackson JA, Roman-Franco A: Orthomo- lecular oncology review: Ascorbic acid and c...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... 117:587-595. 25. Koido S, Hara E, Homma S, Torii A, Mitsunaga M, Yanagisawa M, Toyama Y, Kawahara H, Watanabe M, Yoshida S, Kobayashi S, Yanaga K, Fujise K, Tajiri H: Streptococcal preparation OK-432 pro- motes ... Proc Natl Acad Sci USA 2006, 103:14453-14458. 7. Kitagawa Y, Iwai M, Muramatsu A, Tanaka S, Mori T, Harada Y, Okanoue T, Kashima K: Immunohistochemical localization of CEA, CA1...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
... vaccinated healthy donors. WB from donors naïve or vaccinated with HBsAg was incubated o/n in the presence of a 2 μg/ ml concentration of HBsAg. Following addition of RNAlater, total cellular RNA ... strategy, evaluated the gene expression data and wrote the paper. Acknowledgements This work was partially funded by grants from the Freie Akademische Ges- ellschaft of Basel to...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaque nucleotide sequence (Genbank Acces- sion ... reverse-5'- GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5&a...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Enhanced serum concentrations of transforming growth factor-beta1 in simple fatty liver: is it really benign?" pot
... Domenico Chianese - scopacasa@unina.it; Fabrizio Pasanisi - pasanisi@unina.it; Franco Contaldo - contaldo@unina.it; Francesco Scopacasa - scopacasa@unina.it; Domenico Capone - docapone@unina.it * ... Italy Email: Giovanni Tarantino* - tarantin@unina.it; Paolo Conca - paolo.conca@unina.it; Antonio Riccio - riccio@unina.it; Marianna Tarantino - tarantin@unina.it; Matteo N Di Minno - diminno@...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Effective transvascular delivery of nanoparticles across the blood-brain tumor barrier into malignant glioma cells" docx
... wilsoncm@mail.nih.gov; Kamal Sharma - kamal.sharma@fda.hhs.gov; Maria A Aronova - aronovaa@mail.nih.gov; Richard D Leapman - leapmanr@mail.nih.gov; Gary L Griffiths - griffithsgl@mail.nih.gov; Matthew ... Magnevist dynamic scan data. Dynamic contrast-enhanced MRI data analyses and pharmacokinetic modeling Imaging data was analyzed using the Analysis of Func- tional NeuroImaging (AFNI;...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Phase II trial of Modified Vaccinia Ankara (MVA) virus expressing 5T4 and high dose Interleukin-2 (IL-2) in patients with metastatic renal cell carcinoma" pot
... analysis. The mean age of the ITT population was 58.4 ± 10 years (range 44 – 77 years). 21 patients had clear cell carcinomas and 4 patients had papillary histology. Further characteristics are ... between variables were assessed with adjustments to other variables via lin- ear models. Overall survival (OS) was calculated by the method of Kaplan-Meier, log rank test. OS was calculated...
Ngày tải lên: 18/06/2014, 15:20