Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Tajima K. An epidemiological study of HBV, HCV, and HTLV-1 in Sherpas of Nepal. Asian Pac J Cancer Prev. 2004; 5(4):370-3. 30. Panigrahi AK, Panda SK, Dixit RK, Rao KV, Acharya SK, Dasarathy ... world. Incidence rates across the world fluctuate and are difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence ra...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo Y học: Toxicity of novel C-terminal prion protein fragments and peptides harbouring disease-related C-terminal mutations pdf
... truncated version of PrP c can be converted into a truncated PrP Sc capable of infecting the same transgenic mice and inducing neurodegeneration. The 106 amino acids comprise the amino-acid residues ... converted to a protease resistant form (PrP Sc) that cannot be cleaved at the normal cleavage site. PrP Sc represents an altered isoform that differs markedly in conformation an...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx
... multidimensional, and include physical, psychological and social well-being factors. QoL measure should also take account of the developmental stage of the child, be applicable to all children in a given culture, and ... between parents and children (aged 7 to 11 years) compared to parents and adolescents has also been reported for a study of cancer patients [20]. Child a...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Evaluation of upper extremity robot-assistances in subacute and chronic stroke subjects" doc
... results of observed catching efficiency (CE) and mean forces (MF) during the catching phase of the task. The subacute and chronic subjects are divided into the groups with catching assistance (CA) and ... assistance and grasping assistance on the catching efficiency, placing efficiency and on movement-dependant parameters: mean reaching forces, deviation error, mechanical work...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Control of the upper body accelerations in young and elderly women during level walking" pot
... trial under analysis. Higher values of the coefficients indicate a more effective head stabilisation strategy and a higher reduction of the inertial loads. Statistical analysis The average values ... analy- sis. AC conceived the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript. Acknow...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Behaviour of motor unit action potential rate, estimated from surface EMG, as a measure of muscle activation level" potx
... citation purposes) Background By means of surface electrodes placed at the skin above a muscle the electrical activity accompanying muscle con- tractions can be measured non-invasively (surface ... direction. Morphological, electrical and physiological parameter values were based on data of the biceps brachii (default values of the software package). For a full list of parameter...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Reliability of voluntary step execution behavior under single and dual task conditions" doc
... intraclass correlation coeffi- cient (ICC) [26]. We used ICC(2,1) which assumes each subject is assessed by each rater and the raters are ran- domly selected and reliability calculated from a single measurement. ... effects of age and task condition on the mean depend- ent variables were calculated with SPSS (version 10.1, Chi- cago, IL) using a two-way repeated-measures analysis...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Effects of visually simulated roll motion on vection and postural stabilization" pptx
... that was computed for each COP and head position as arithmetic averages of standard deviations across periods of the identical condi- tion or of the same category of perception. The postural ... and A/ P directions, and are shown in Tables 1, 2, 3 and 4 along with the standard deviations. The detailed time-series data are shown graph- ically in Figures 4c and 4d, and 5c...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Inhibition of secreted phospholipase A2 by neuron survival and anti-inflammatory peptide CHEC-9" docx
... A2 s (sPLA2s) are of interest in this regard because of their accessibility in the circulation and because local and systemic elevation of sPLA2s are associ- ated with most forms of inflammation ... Sapirstein A, Hung CC, Alessandrini A, Bonventre JV: Cross-talk between cytosolic phospholipase A2 alpha (cPLA2 alpha) and secretory phospholipase A2 (sPLA2) in hydrogen peroxid...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot
... bp commercially available Genexpression Assay QuantiTect Mm_ Tnfsf6 241122 C1 -Inh 12258 NM_009776 134 bp AACTTAGAACTCATCAACACCT GTTATCTTCCACTTGGCACTC ACACCTGCCTCGTCCT custom made * NCBI, National ... alternative pathway complement activity (zymosan assay) and a significant inhibition of complement anaphylatoxin C5 a levels (ELISA data) at 4 and 24 hours after trauma, compared to...
Ngày tải lên: 19/06/2014, 22:20