Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc

... purposes) Virology Journal Open Access Research A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes Alagarsamy Srinivasan* 1 , Velpandi Ayyavoo* 2 , ... Pennsylvania School of Medicine, Dept of Pathology and Laboratory Medicine, 243 John Morgan, Philadelphia PA 19104, USA Email: Alagarsamy Srinivas...

Ngày tải lên: 20/06/2014, 01:20

... majority" of subjects completed a certain number of classes or that there was a natural break in the data at a certain number of classes. This is problematic in that the "dose" of the intervention ... duration and intensity of the exercise, attrition, and outcome variables from the meth- ods section of the full text articles or from the abstr...

Ngày tải lên: 20/06/2014, 16:20

... time. Furthermore, these data can be stored in a database. Uti- lizing this system, the values of the progress in the exer- cises can easily be stored and re-accessed for further examination and evaluation. Competing ... target. All participants were tested between 10 AM and 4 PM. All tests were performed with the right hand. Data analysis Kinematic data sampling and informa...

Ngày tải lên: 19/06/2014, 10:20

... that although the high levels of mutation caused difficulties in the development of vac- cines against new strains of the influenza, there are effec- tive vaccines against specific strains of the ... regions could be crucial for the inter-subunit interactions. In fact, analysis of the crys- tal structure of the p15 protein revealed that residues 46 and 78 of...

Ngày tải lên: 20/06/2014, 01:20

... Cerri 1 , Ana Cristina N Chiaradia 1 , Alex A Carvalho 4 , Ian V Silva 3 and Leticia BA Rangel 1* Abstract Background: Ovarian cancer is sixth most common cancer among women and the leading cause of ... based on the combina- tion of a platinum-derived compound (carboplatin, mainly, or cisplatin), and a taxane (paclitaxel). As documented by Aebi and Castiglione [35], the refe...

Ngày tải lên: 20/06/2014, 08:20

... insight into the causes of the distinct behavior of daunorubicin and WP631, we compared the intracellular accumulation of these com- pounds in Jurkat T cells overtime. We also examined the rate ... phase contrast and fluorescence photo- graphs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluore...

Ngày tải lên: 20/02/2014, 23:20

... mutations on RNA-binding and cleavage assays were evaluated. A RNA binding assay of the different mutants was performed using native MS, as indicated above. In all cases, the relative binding percentages ... (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTA...

Ngày tải lên: 16/03/2014, 03:20

... immuno- chemical staining to examine the cell population of AT-MSC-Hepa for microarray analysis. This analysis showed that the AT-MSC-Hepa cell population was almost totally homogeneous ([16], and data not ... 1267 the up- and down-regulated gene data using an Euclidean distance calculation based on the Ward method calculation by genmaths software (Applied Maths, Austin, TX, US...

Ngày tải lên: 30/03/2014, 04:20

... speaker differences. Table 1: Classification accuracy of different learn- ing methods for the task of classifying the transcript of a conversation side according to the gender - male/female - of ... side? Each conversation always consists of two people talking to each other. Up to this point, we have only attempted to analyze a conversation side in isola- tion, i.e. witho...

Ngày tải lên: 31/03/2014, 03:20

... Medical College of Wisconsin, Milwaukee, WI, USA and 4 Section on Statistical Genetics, Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL, USA Email: Julie A Panepinto* ... functioning. The total score is comprised of the average of all items in the questionnaire. The psychosocial summary score is comprised of the average of the...

Ngày tải lên: 18/06/2014, 18:20