Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

... have been associated with all of the past influenza pandemics [4,5]. Influenza A viruses are classified into subtypes according to the hemagglutinin (HA) and neuraminidase (NA) glyc- oproteins that are ... repeat the assay because our RNA stock of those 2 samples was exhausted. The fact that there was no virus isolated for those samples does not necessarily explain the...

Ngày tải lên: 20/06/2014, 01:20

... Chen and X. Zhu, A note on BMO and its application,” Journal of Mathematical Analysis and Applications, vol. 303, no. 2, pp. 696–698, 2005. 18 H. Kozono and H. Wadade, “Remarks on Gagliardo-Nirenberg ... regularity of weak solutions of the Navier-Stokes equations,” Archive for Rational Mechanics and Analysis, vol. 9, no. 1, pp. 187–195, 1962. 3 T. Ohyama, “Interior regularity of...

Ngày tải lên: 22/06/2014, 02:20

... model having a flat mainlobe and a flat sidelobe is developed. The width of the mainlobe and the height of the sidelobe are calculated based on the first moment and the second moment of the real beam ... (17) 4.2. Partial-Band Interference. Partial-band interferers occupy part of the hoped bandwidth. A partial-band interferer to a DS/FH signal is the same as a...

Ngày tải lên: 21/06/2014, 19:20

... Exon1 and flanking introns by PCR/ sequencing. The PCR primers used are forward primer: 5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3' and reverse primer 5'GGGGCTGGACCAACACACGTC- CTT GGG3'. ... forward primer 5'TTGGTGTTTGCTCAGGAAGA 3' and reverse primer 5'GGCCTACAGGGGTTTCAAAT 3'. Among this study cohort, 851 patients from central China were also ana- lyzed...

Ngày tải lên: 18/06/2014, 15:20

... involvement of other modifier factors in the phenotypic manifestation of these putative deafness-associated 12S rRNA variants, as in the case of these families carryin g the 155 5A > G mutation [39]. Further ... the presence o f mtDNA variants were o btained from a panel of unaf- fected Han Chinese subjects from the same region. Mutational analysis of mitochondri...

Ngày tải lên: 18/06/2014, 16:20

... Rehabilitation NOCSAE Hospital AUSL of Modena, Modena, Italy Full list of author information is available at the end of the article Bovolenta et al. Journal of NeuroEngineering and Rehabilitation ... processed the data. VDA performed the statistical analysis. FB, PS, and VDA wrote the manuscript. All authors read and approved the manuscript. Competing interests The autho...

Ngày tải lên: 19/06/2014, 08:20

... additional hour at 45°C. After additional washes, the color reaction was started by adding the appropriate substrate. Absorbance was measured at 492 nm. Each assay included a standard curve derived from ... results indicate that measurement of saliva sHLA-II may be a potential noninvasive biological marker of disease activity in a primary CNS disease such as MS. Competing inte...

Ngày tải lên: 19/06/2014, 22:20

... few cases are reported each year. In countries like Thailand and Malaysia only a handful of mesotheliomas have been identified, and in Taiwan, less than 10 cases of mesothelioma (387 cases from ... is that of the gender and age adjusted general popu- lation. Another reference risk could be the archaic risk of cancer, e.g. the estimated or a ssumed age and gen- der-adjusted...

Ngày tải lên: 20/06/2014, 00:20

... ML, Pham L, McDermott A, Zeger SL, Samet JM: Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases. Jama-Journal of the American Medical Association ... to the conception and design of the review, acquisition of the review data and have been involved in drafting and revising the manuscript. All authors have read and approved th...

Ngày tải lên: 20/06/2014, 00:20

... located in 8~26 ACCTCTGCCTAATCATCTC X/preC 40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC 591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein 993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein 1450~1469 ... defined as sites within the desired locations that had 17+ bases from the 3' end and with a frequency of 0.90+ in the BxB. The output of BxB analysis was desig- nated as...

Ngày tải lên: 20/06/2014, 01:20