Báo cáo hóa học: " Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection at a crossroads of intercontinental flyways" potx
... Central Page 1 of 10 (page number not for citation purposes) Virology Journal Open Access Research Prevalence of Influenza A viruses in wild migratory birds in Alaska: Patterns of variation in detection ... prevalence in surface-feeding ducks (Anatidae, tribe Anatini, 7.0%), followed by seabirds Geographical location of sampling sites in Alaska in 2...
Ngày tải lên: 20/06/2014, 01:20
... Brownstein Z, Marlin S, Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D, Dahl HH, Estivill X, Gasparini ... possible head or brain injury, and the use of aminoglycoside anti- biotics. All subjects showed moderate to profound bilat- eral sensorineural hearing impairment on audiograms. Careful...
Ngày tải lên: 18/06/2014, 16:20
... data. He has been involved in drafting the manuscript AS has made substantial contributions to conception and design, acquisition of data, as well as to analysis and inter- pretation of data. ... quality. Because of the inadequate data, it is difficult to evaluate the tubercu- losis risk in different medical specialties. The results are contradictory and all in all do not indicate...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... is translated. Stability of polymerase-template interactions at elevated temperature Given our observations of heat stable transcriptionally active polymerase and near normal accumulation of plus- sense ... suggesting that repli- cation of influenza virus is regulated by stabilization of repli- cative intermediates. J Virol 2004, 78: 9568-9572. 22. Nakagawa Y, Oda K, Nakada S:...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Prevalence of Helicobacter pylori in HIV-infected, HAART-naïve Ugandan children: a hospital-based survey" ppt
... living in the area of Mulago Hill and, at the same time, the role of a national referral hospital for Uganda. Participants were enrolled from the general paediatric medical wards, the acute care ... [http://www. aidsuganda.org]. 3. Sharpstone D, Gazzard B: Gastrointestinal manifestations of HIV infection. Lancet 1996, 348:379-383. 4. Wallace MR, Brann OS: Gastrointestinal manifest...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt
... crucial to obtain nationwide estimates of low vision and blindness preva- lence rates so that sufficient resources are allocated appro- priately (medical and non-medical), especially when increasing ... Access Research Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach Antoine J Lafuma 1 , Antoine P Brézin 2 ,...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học: " Prevalence of multiple chronic conditions in the United States'''' Medicare population" pot
... prostate cancer - with a median age for diagnosis at 68 years [9]. Cancer is the leading cause of death among people 60-79 years of age. In 2006 it was estimated that COPD affected approximately ... determine whether there was an indication of receiving evaluation of or treatment for the condition of interest. There is always a risk with administrative data sources that a...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Prevalence of stress, anxiety and depression in with Alzheimer caregivers" ppt
... problems and depression that has negative repercussions on the family. Table 2: Median values of MMSE, ADL and IADL of patient and caregiver's CBI. Patients Caregiver Variables Median values Variables ... "Dottore Angelico" di Aquino, Italy Email: Maria Ferrara* - m.ferrara@unicas.it; Elisa Langiano - langiano@unicas.it; Tommasina Di Brango - tommasina.dibrango@virgiolio.i...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Prevalence of and factors influencing posttraumatic stress disorder among mothers of children under five in Kabul, Afghanistan, after decades of armed conflicts" ppt
... participated in the study design and conducted a survey, HS took part in data col- lection and data base preparation and KN participated in the study design, data analysis, and editing the manu- script. ... and mental health status of Cam- bodians living in Thailand-Cambodia border camps. JAMA 1993, 270:581-586. 10. Somasudaram DJ, Sivayokan S: War trauma in a civilian popula-...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Prevalence of transfusion transmitted virus (TTV) genotypes among HCC patients in Qaluobia governorate" doc
... Gohary A, Hassan A, Nooman Z, Lavanchy D, Mayerat C, el Ayat A, Fawaz N, Gobran F, Ahmed M, Kawano F: High prevalence of hepatitis C virus among urban and rural population group in Egypt. Acta ... 45 s at 60°C, and extension for 45 s at 72°C, with the sense primers 5'ACAGACAGAGGAGAAGGCAACATG3' (nt 1920–1943, NG059) and anti-sense primer 5'CTGGCATTTTACCATTTCCAAAGTT3...
Ngày tải lên: 20/06/2014, 01:20