Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx

... The eluted mAbs and mAb-FIs were concentrated and stored at -80°C. Analytic characterization of proteins The protein concentration of mAb and mAb-FI samples was determined by measuring the optical density ... Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1 Erhard Kopetzki †1 , Andreas Jekle †2 , Changhua Ji 2 , Eileen Rao 2 , Jun Zhang 2 ,...

Ngày tải lên: 20/06/2014, 01:20

... out patient recruitment, randomization and logistics of the data collection. CLS was the principal investigator and participated in the data collection and analysis and preparation of the manuscript. ... immunohistochemical pre parations, data collection, data analysis and preparation of the manuscript. JWP independently performed data collection and analysis and criticall...

Ngày tải lên: 18/06/2014, 16:20

... round of PCR with VJ23 and SIVG3 (5' TGTTGTCTGTACATCCACTGGAT 3'), SIVG1 (5' AGCG- GCAGAGGAGGAAATTAC 3') and VJ25 (5'-CTACT- GGTCTCCTCCAAAG 3') respectively (encompassing ... 2 Evaluation of plasma viral RNA levels and cell-associated viremia in SIV-challenged macaques. a- Plasma viral load in 8 lipopeptide-vaccinated (102, 105, 109, 117, 120, 125,...

Ngày tải lên: 20/06/2014, 01:20

... The authors have derived the SRL expressions w.r.t. P fa and P d inthecaseofrealreceivedsignals ,and unequal and unknown amplitudes and phases. In [13], Liu and Nehorai have defined a statistical ... which ω (p) =  ω (p) 1 ω (p) 2  T . (7) whereas r contains the unknown nuisance/unwanted parameters vector, i.e., characterizing the noise covar- iance matrix and/ or amplitude and...

Ngày tải lên: 21/06/2014, 03:20

... during a 10-h annealing at the Figure 3 Composition analysis of a Bi 2 Te 3 nanowire (a) A HAADF image of the Bi 2 Te 3 nanowire. (b) EDS line scan profiles showing the distributions of Bi (cyan, ... Education, Science and Technology. Authors’ contributions J.K carried out this nanowire growth experiment and character analysis and drafted the manuscript. J-S.N participated i...

Ngày tải lên: 21/06/2014, 04:20

... 5'-TGAGGAGGTCCGAGTTCTTG-3' FOS F: 5'-CAAGCGGAGACAGACCAAC-3' R: 5'-GAGCTGCCAGGATGAACTC-3' HSPB8 F: 5'-AGCCAGAGGAGTTGATGGTG-3' R: 5'-TGCAGGAAGCTGGATTTTCT-3' GAPDH ... 5'-AGCCCTACGAGCACCTGAC-3' R: 5'-AGCGGCCAGTATAGGTGATG-3' PDK4 F: 5'-GTCCCTACAATGGCACAAGG-3' R: 5'-GGTTCATCAGCATCCGAGTAG-3' JUN F: 5'-GAG...

Ngày tải lên: 18/06/2014, 16:20

... immunotherapy can form a practical partnership in the treatment of cancer. Additional material Additional file 1: Anti-IMP321 antibodies. Sera collected at baseline and 2 weeks after the sixth and the ... oaded (at least two determinations/sam- ple) on microtiter plates (Ma xisorb, NUNC) precoated with IMP321 (1 μg/well) and revealed by a mix of HRP- conjugated goat anti-human...

Ngày tải lên: 18/06/2014, 16:20

... markers at per-auricular areas. The y-axis is perpendicular to the frontal plane passing through markers at the forehead and bila teral pre-auricular areas. The z-axis is ortho go- nal to x-andy-axis. ... collection and analysis. FGY participated in the data interpretation and the revising of this manuscript. LYY carried out the data collection and analysis. CYW carried out the data...

Ngày tải lên: 19/06/2014, 08:20

... mazes by means of the keyboard; left-right, up-down and forward-backward movements are allowed and a standard speed of walk is maintained. In order to find the exit point, a maximum time is allowed, ... marialuisa.rusconi@unibg.it 1 Department of Human Science, University of Bergamo, Bergamo, Italy Full list of author information is available at the end of the article Care...

Ngày tải lên: 19/06/2014, 08:20

... date. Author details 1 Medicine Rehabilitation NOCSAE Hospital AUSL of Modena, Modena, Italy. 2 IRCCS San Raffaele Pisana, Rome, Italy. 3 Clinical and Molecular Epidemiology, IRCCS San Raffaele ... suggest that a motor and functional recovery takes place and can be interpreted as a possible result of the process of adaptation. In addition, it was also pos sible to observe a...

Ngày tải lên: 19/06/2014, 08:20