Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

... Científicas, Caracas) and a sec-ondary antibody conjugated to alkaline phosphatase. Fociwere stained using a combination of 5-bromo-4-chloro-3'-indolylphosphate p-toluidine salt and nitro-blue ... Recently, a commercial enzyme immunoassay, Platelia™ Dengue NS1 AG (Bio-Rad Laboratories), wasdeveloped for the detection of NS1 antigen in humanserum or plasma. This assay has been reported to be usefulfor ... Kalayanarooj S,Nisalak A, Norman JE, Ennis FA, Rothman AR: Analysis of plasmaviral RNA levels during acute dengue virus infection usingquantitative competitor reverse transcription-polymerasechain...

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

... balance maintenance and arm transport. All participants practicedten 90-s gaming trials during a single session, followed by a retention test. Arm-postural coordination was analysedusing principal ... train-ing arm-postural coordination, utilized the basic principles of game design, and included tasks calibrated according to the patient’s anatomical features and movement abilities.This paper ... with a traumatic brain injury. Brain Inj 2002,16:231-244.5. Kuhtz-Buschbeck JP, Stolze H, Gölge M, Ritz A: Analyses of gait, reaching,and grasping in children after traumatic brain injury. Arch...

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

... insoluble material and immu-noprecipitated by incubation with a saturating amount(as determined by prior titration) of a cocktail containing1.5 µgs of anti-F mAbs and protein -A agarose beads (Inv-itrogen, ... Fprotein and a transcriptional transactivator fusion proteinconsisting of the GAL4 DNA-binding domain fused to theactivation domain of NFκB. These effector cells weremixed with a separate set of ... mMnon-essential amino acids, 1.0 mM sodium pyruvate and10% heat-inactivated, gamma-irradiated fetal bovineserum (FBS) (HyClone Laboratories, Salt Lake City,Utah). AK-D cells (CCL-150) were maintained in...

báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

... (Clínica CLINISAS, Madrid), I Vallejo (HospitalClinic, Barcelona), J Vidal (Hospital General, Guadalajara). Milena Gobbo andUnidad de Investigación de la Fundación Española de Reumatolog a, fortheir ... technical support.Author details1Facultad de Psicolog a, Universidad Nacional de Educación a Distancia,Madrid, Spain.2Unidad de Reumatolog a, Instituto Provincial deVallejo et al. Health and ... (ICAF)An exploratory factor analysis was made involving thescales resulting from i tem reduction indicated in thesection above. With a KMO of 0.86, four factorsexplaining 64% of the variance...

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...

Báo cáo hóa học: " Research Article A Uniﬁed Approach to List-Based Multiuser Detection in Overloaded Receivers" pot

... 2:SystemmodelforaULAandaUCAwithM = 4-elementsand D>Msingle-antenna users.2.2. Uniform linear array In the ULA conﬁguration, isotropic antenna elements arelocated in a straight line with equal spacing ... 1996.[9] S. Talwar and A. Paulraj, “Blind separation of synchronousco-channel digital signals using an antenna array—part II:performance analysis,” IEEE Transactions on Signal Processing,vol. ... incident onthe antenna array with greater spread in AOA interfere witheach other less than signals that are closely spaced in AOA.CCI from users reasonably widely spaced in AOA can thusbe eﬀectively...

Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

... at 37 °C in an incubator containing 5%CO2and maintained by regular passage in Dulbecco’sminimal essential medium (supplemented with 10% heat-inactivated fetal bovine serum, 2 mML-glutamine ... that cyclosporin A (CsA), vinblastine, and valinomycin (and several otherdrugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo´Jr,unpublished data)1interactwithPgpinsuchamannerthatpreincubation ... concentrations of thechemicals applied increased steady-state daunorubicinaccumulation to the approximate level reached in Pgp–parental cells and did not signiﬁcantly increase the ratio of dead...

Báo cáo khoa học: Effect of ecdysone receptor gene switch ligands on endogenous gene expression in 293 cells docx

... exocyticand endocytic pathways because Rab proteins plays a key role in membrane trafﬁcking [25]. Barbosa et al.[26] reported that mutations in the Rab gene(s) cancause irregularities in the protein ... D. melanogaster DabIP. The DabIP partici-pates in a signaling complex containing various pro-teins involved in brain development as well as otheraspects of adult brain function [55]. Although ... Keshvara L, Rice DS &Curran T (2003) Interaction of Disabled-1 and theGTPase activating protein Dab2IP in mouse brain. MolBrain Res 115, 121–129.56 Piddini E, Schmid JA, Martin R &...

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

... Figure 2a, saturation of binding was achieved at a concentration of 60–70 nM of AF488-MCP-1. Since the internalization assay is to beused as a measure of pharmacodynamic effect of a CCR2antagonist, ... cytometry-based pharmacodynamic assays. Herewe report the validation of a flow cytometry-based chemokine internalization assay for use in evaluating the effect of a receptor antagonist in clinical trials. ... individualsand all days (Table 5). In- study resultsThis assay was used as a pharmacodynamic marker forbiological activity of a CCR2 antagonist in a clinical trialconsisting of 108 healthy individuals....

báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx

... of pain relieving/anti-inflammatory drugs to treat arthritis and bodily pain,which predominated as reasons for NSAID use (in the CFSgroup). The significantly more common use of narcoticpain ... were taking such drugs to reduce the stomach side effects of an NSAID (etodolac).Among users of pain-relieving/anti-inflammatory drugsonly, concurrent use of anti-acid drugs was significantlymore ... frequency of use of NSAIDs (aspirin excluded) among controls in our studyappears comparable to the 32% estimated prevalence of joint pain in the general population of Georgia, or 33%for the USA [17],...

Xem thêm