Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

... Científicas, Caracas) and a sec- ondary antibody conjugated to alkaline phosphatase. Foci were stained using a combination of 5-bromo-4-chloro- 3'-indolylphosphate p-toluidine salt and nitro-blue ... Recently, a commercial enzyme immunoassay, Platelia™ Dengue NS1 AG (Bio-Rad Laboratories), was developed for the detection of NS1 antigen in human serum or plasma. This...

Ngày tải lên: 20/06/2014, 01:20

8 384 0
Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

... balance maintenance and arm transport. All participants practiced ten 90-s gaming trials during a single session, followed by a retention test. Arm-postural coordination was analysed using principal ... train- ing arm-postural coordination, utilized the basic principles of game design, and included tasks calibrated according to the patient’s anatomical features and movement abilities....

Ngày tải lên: 19/06/2014, 08:20

11 793 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

... insoluble material and immu- noprecipitated by incubation with a saturating amount (as determined by prior titration) of a cocktail containing 1.5 µgs of anti-F mAbs and protein -A agarose beads (Inv- itrogen, ... F protein and a transcriptional transactivator fusion protein consisting of the GAL4 DNA-binding domain fused to the activation domain of NFκB. These effector cells...

Ngày tải lên: 20/06/2014, 04:20

12 541 0
báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

... (Clínica CLINISAS, Madrid), I Vallejo (Hospital Clinic, Barcelona), J Vidal (Hospital General, Guadalajara). Milena Gobbo and Unidad de Investigación de la Fundación Española de Reumatolog a, for their ... technical support. Author details 1 Facultad de Psicolog a, Universidad Nacional de Educación a Distancia, Madrid, Spain. 2 Unidad de Reumatolog a, Instituto Provincial de Vallejo et al....

Ngày tải lên: 18/06/2014, 19:20

7 460 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 ... CGTATAAATTACAATACCG Spcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAAT...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Báo cáo hóa học: " Research Article A Unified Approach to List-Based Multiuser Detection in Overloaded Receivers" pot

Báo cáo hóa học: " Research Article A Unified Approach to List-Based Multiuser Detection in Overloaded Receivers" pot

... 2:SystemmodelforaULAandaUCAwithM = 4-elements and D>Msingle-antenna users. 2.2. Uniform linear array In the ULA configuration, isotropic antenna elements are located in a straight line with equal spacing ... 1996. [9] S. Talwar and A. Paulraj, “Blind separation of synchronous co-channel digital signals using an antenna array—part II: performance analysis,” IEEE Transactions on Sign...

Ngày tải lên: 21/06/2014, 22:20

14 209 0
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

... at 37 °C in an incubator containing 5% CO 2 and maintained by regular passage in Dulbecco’s minimal essential medium (supplemented with 10% heat- inactivated fetal bovine serum, 2 m ML -glutamine ... that cyclosporin A (CsA), vinblastine, and valinomycin (and several other drugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo ´ Jr, unpublished data) 1 interactwithPgpinsuchamannerthat prei...

Ngày tải lên: 08/03/2014, 23:20

6 590 0
Báo cáo khoa học: Effect of ecdysone receptor gene switch ligands on endogenous gene expression in 293 cells docx

Báo cáo khoa học: Effect of ecdysone receptor gene switch ligands on endogenous gene expression in 293 cells docx

... exocytic and endocytic pathways because Rab proteins plays a key role in membrane trafficking [25]. Barbosa et al. [26] reported that mutations in the Rab gene(s) can cause irregularities in the protein ... D. melanogaster DabIP. The DabIP partici- pates in a signaling complex containing various pro- teins involved in brain development as well as other aspects of adult brain fu...

Ngày tải lên: 30/03/2014, 03:20

21 414 0
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

... Figure 2a, saturation of binding was achieved at a concentration of 60–70 nM of AF488-MCP-1. Since the internalization assay is to be used as a measure of pharmacodynamic effect of a CCR2 antagonist, ... cytometry-based pharmacodynamic assays. Here we report the validation of a flow cytometry-based chemokine internalization assay for use in evaluating the effect of...

Ngày tải lên: 18/06/2014, 15:20

12 829 0
báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx

báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx

... of pain relieving/anti- inflammatory drugs to treat arthritis and bodily pain, which predominated as reasons for NSAID use (in the CFS group). The significantly more common use of narcotic pain ... were taking such drugs to reduce the stomach side effects of an NSAID (etodolac). Among users of pain-relieving/anti-inflammatory drugs only, concurrent use of anti-acid drugs...

Ngày tải lên: 18/06/2014, 19:20

11 512 0
w