Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc

... affinity to that exhibited by the Nef :SH3 domain interaction. We conclude that NS5A binds to SH3 domains with high affinity, and such interactions could occur in the context of an HCV infected cell. Results ... interactions with the SH3 domain of the Src- family tyrosine kinase, Fyn. Surface plasmon resonance analysis revealed that NS5A binds to...

Ngày tải lên: 20/06/2014, 01:20

... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAACCCG-3' (initiation codon ... 5'-GGGACGCGTTTAAACCAATGGCA- GAAGCTCC-3' and 5'-TGCGGTACCGGCTAAATCG- CAACTGCTTCCCCAG-3' (for IFN-λ1 promoter), 5'- GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3&apo...

Ngày tải lên: 20/06/2014, 01:20

... pACT- MyoD. The negative control reaction consisted of 0.4 ng of each of the following vectors, pG5luc, empty pACT vec- tor and the GNβ5-pBIND vector. The actual experimental reaction to confirm the ... designed with NcoI and PstI enzyme restriction sites as follows: 5'-TGCCATGGCAATGGCTGCTAGGCTGTACTGCC-3' 5'-AACTGCAGTTAGGCAGAGGTGAAAAAGTT-3' The PCR prod...

Ngày tải lên: 20/06/2014, 04:20

... applied to gather relevant socio-demographic characteristics of these women (age, education, gestational age, parity, resi- dence, occupation). Then the possible risk factors (history of surgery ... none of the expected risk factors (age, parity and the other socio-demographic characteristics) for sero-positivity for HBVsAg had been identified in the current study. The explana...

Ngày tải lên: 20/06/2014, 01:20

... occur when the HCV core protein is strongly expressed. [26] The core protein has been located at the surface of lipid droplets within the cytoplasm in cell cultures that are transfected with ... that the hepatitis C virus, in and of itself, can directly induce cytoplasmic lipid accumulation. Further studies examining the genotype 3 virus are warranted to...

Ngày tải lên: 02/11/2012, 09:51

... marker profiles can be observed according to the presence or absence of either marker. The presence of HCV RNA in the absence of anti-HCV antibodies is strongly indicative of acute HCV infection, ... professional societies, currently acting as the Scientific Secretary of the European Association for the Study of the Liver (EASL), and he is a member of the S...

Ngày tải lên: 02/11/2012, 09:56

... for second-round PCR were designed on the basis of the differences in the sizes of the genotype-specific bands. The type-specific primers were designed on the basis of the conserved nature of those sequences ... infections accounted for 45.5% of the total mixed infections. We conclude that HBV mixed genotype infections could probably be of clin- ical significance...

Ngày tải lên: 20/06/2014, 01:20

... (G1896A), which creates a stop codon in the precore region of the HBV genome and completely abolishes the production of HBeAg [35]. Other variants include changes in the start codon of the precore region ... superinfection with other hepatotropic viruses. As many as 20 to 30% of these acute exacerbations may be caused by superinfection with HDV, HCV, or hepatitis A vi...

Ngày tải lên: 20/06/2014, 04:20

... restriction sites as follows: 5'-TGCCATGGCAATGGCTGCTAGGCTGTACTGCC-3' 5'-AACTGCAGTTAGGCAGAGGTGAAAAAGTT-3' The PCR product and the binding domain vector, pGBKT7 of 7.3 kb (MATCHMAKER ... 0.186. They exceeded the calculated cut-off of 0.179, thus indicating the presence of HBsAg. The results of this assay run were valid as the criteria for the quality...

Ngày tải lên: 19/06/2014, 08:20

... the prevalence and clinical significance of occult HBV infection in patients with chronic hepatitis C. The result showed that 21 of the 66 patients with HCV infection and occult HBV infection ... combined effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for developme...

Ngày tải lên: 02/11/2012, 09:51