Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf

... stand- ardized a one step single tube protocol for rapid serotyping of dengue viruses. This assay can be performed rapidly with in a period of 4 hours compared to 8 hours in two -step typing assays. ... 3' and Ts4: 5'TGTTGTCTTAAACAAGAGAGGTC3'), as reported earlier [6]. Single -step Dengue multiplex RT-PCR (M -RT-PCR) A one- step single tub...

Ngày tải lên: 20/06/2014, 01:20

... Division of Infectious Diseases, Brown University, Providence, Rhode Island, 2 Assistant Professor, Division of Infectious Diseases, Stanford University, Stanford, California and 3 Professor, ... Division of Infectious Diseases, Stanford University, Stanford, California * Corresponding author HIV Diversity and Drug Resistance HIV-1 group M, the major pathogen responsible for...

Ngày tải lên: 20/06/2014, 08:20

... if one of the following two conditions holds: (i) their nearest ancestor has the distance of exactly x hops to one of them and the distance of at most x hops to the other one, or (ii) one of ... 4–11) of the five free codes as 1, 3, 3, 3, and 3, respectively. CBP computes the W 2,j values of codes C(3, 2) to C(3,5)as1,1,2 ,and2 ,respectively ,and then chooses one o...

Ngày tải lên: 21/06/2014, 11:20

... FS ∩ FT for the set of all common fixed points of the mappings S and T. Lemma 2.1. Let C be a nonempty closed convex subset of a normed space E.LetS, T : C → C be asymptotically nonexpansive ... that one needs two different sequences {s n } and {t n } for the mappings S and T used in 1.3, but it is readily answered when one takes k n  sup{s n ,t n }. Henceforth, we wi...

Ngày tải lên: 22/06/2014, 03:20

... dementia and the development of caregiver stress and burden [5]. Families often report that behavio- ral disturbances are the primary source of stress and the primary cause for institutionalization of ... York: Oxford University Press; 2005. BioMed Central Page 1 of 12 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research De...

Ngày tải lên: 18/06/2014, 18:20

... measure for child and adolescent acceptance of asthma, to measure one aspect of quality of life believed to influence one& apos;s overall quality of life. Adolescents with asthma identified level of participation ... important considera- tions in development of the scale: 1. Level of participation in self-selected activities offers a measure of one aspect of quali...

Ngày tải lên: 18/06/2014, 22:20

... medi- cal professions. As a point of criticism, using this methodology is very time and effort intensive; observational data contains an extremely wide amount of information. The more infor- mation ... reorganization of categories and addi- tions or deletions of tasks. After all task lists were verified for completeness and accuracy they were implemented in the data collection...

Ngày tải lên: 20/06/2014, 00:20

... from peak) had a sensitivity of 67% for a viral load of >1000 copies/mL, a specificity of 82%, and identified 22% of patients for viral load testing. Sensitivity of the WHO-based algorithm was ... Frederick, MD, USA, 4 National Institute of Allergy and Infectious Diseases, National Institutes of Health, USA and 5 Institute of Tropical Medicine and University...

Ngày tải lên: 20/06/2014, 08:20

... studies related to assay development, Khetemenee Lam and Stephane Olland for pro- viding rhIL21, and Mary Collins, Cheryl Nutter and Davinder Gill for critical review of the manuscript. Author ... contributed to the writing of the manuscript. MFS was responsible for interface with the clinical team and for securing and scheduling the resources that will be required up...

Ngày tải lên: 18/06/2014, 16:20

... for 30 sec, 59°C for 45 sec and 72°C for 60 sec, and finally 72°C for 5 min. The PCR reactions were carried out in 25 μlvolumesin thepresenceof6ng/μl of each of the forward and the reverse primers ... PCR and ISH results show that 62 out of 67 (92.5%) and 64 out of 67 (95.5%) positively expressed varying levels of IGF2-P4 and H19, respectively. Comparison of th...

Ngày tải lên: 18/06/2014, 16:20