Báo cáo hóa học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" pdf
... hantavirus, designated Seewis virus (SWSV), detected in the Eurasian common shrew. These findings add to the expanding database on soricid-associated hantaviruses and forecast that many more hantaviruses ... Richard Yanagihara - yanagiha@pbrc.hawaii.edu * Corresponding author Abstract More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian c...
Ngày tải lên: 20/06/2014, 01:20
... Richard Yanagihara - yanagiha@pbrc.hawaii.edu * Corresponding author Abstract More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian common shrew (Sorex araneus), Eurasian ... of hantavirus antigens in S. araneus in the former Yugoslavia and Russia [15-17]. The important distinction is that we now have sequence data to substantiate th...
Ngày tải lên: 18/06/2014, 18:20
... (4436–4455) - 5090 R TCATTCGACGCCATCTTCATT (5084–5104) - 4290 F TCACTATGATGCTGATTACTC (4282–4302) - NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) + NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) - Virology ... V 540 AAD40497 480 P A 539 AAT12693 480 P A 539 AAD40488 480 P A 539 AAT12696 480 P A 539 AAL79839 480 P A 539 AAL18876 480 P A 539 AAT12689 480 P A 539 AAT1268...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf
... TPM- M-F1 (5'-TAGTAGTAGACTCCGCA-3) and TPM-M-R3684 (5'-TAGTAGTATRCTCCGCARG-3), and HANTA-L-F2, (5'- TAGTAGTAGACTCCGGAAG-3') and HANTA-L-R6577 (5'-TAGTAGTATGCTCCGRGAA-3') ... associated with infection by Murinae- and Arvicolinae-associated hantaviruses (e.g. Hantaan, Seoul and Puumala viruses) and hantavirus pulmonary syndrome (HPS) is associated with Sigmodonti...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Frag-Virus: a new term to distinguish presumptive viruses known primarily from sequence data" pdf
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học: " Validation of a French language version of the Early Childhood Oral Health Impact Scale (ECOHIS)" ppt
... impact increasing by age. In examining the internal consistency of the French ECO- HIS, using data from the community-based sample, we found Cronbach's alpha values of 0.79 and 0.79 for the child ... citation purposes) lated using the INTRACC macro in SAS was used to evalu- ate test-retest reliability. All data analyses were performed using the SAS program (SAS 7.0). Resu...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Characteristics of non-AIDS-defining malignancies in the HAART era: a clinico-epidemiological study" doc
... SDW participated in the study design, data analysis, and writing of the paper. MD extracted the data, and performed part of the statistical analysis. VCN encoded the data, and was in charge of the cohort. ... Wit * , Marc Delforge, Valentina Coca Necsoi and Nathan Clumeck Abstract Background: Non-AIDS-defining malignancies (NADM) are becoming a major cause of mortality in...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Medication quality and quality of life in the elderly, a cohort study" doc
... contributions INO participated in the design of the study, the statistical analysis and the drafting of the manuscript. RR participated in the statistical analysis and the drafting of the manuscript. PE participated ... participated in the design of the study and the drafting of the manuscript. All authors read and approved the final manuscript. Competing inter...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx
... If no data have been relayed within the allowed waiting time, the system generates a new packet which combines all parameters that have the same destination. As a result, information exchanges ... can associate metadata with, or r etrieve metadata from, stored packets using the packet facade. b Only the packet facade requires knowledge about the packet format. As long as the...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article A Salient Missing Link in RFID Security Protocols" potx
... attack model and will be a basis for many RFID authentication protocols that are vulnerable to the attack. 3. The Timing Attack Timing attacks provide an attacker with secrets maintained in a security ... and each T and may make any ReaderInit or TagInit calls in any interleaved order without exceeding its parameter bounds. (2) Challenge Phase. in this phase, the adversary A...
Ngày tải lên: 21/06/2014, 05:20