Báo cáo hóa học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" pdf
Báo cáo hóa học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" pdf
... hantavirus, designated
Seewis virus (SWSV), detected in the Eurasian common
shrew. These findings add to the expanding database on
soricid-associated hantaviruses and forecast that many
more hantaviruses ...
Richard Yanagihara - yanagiha@pbrc.hawaii.edu
* Corresponding author
Abstract
More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian c...
Báo cáo sinh học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" doc
...
Richard Yanagihara - yanagiha@pbrc.hawaii.edu
* Corresponding author
Abstract
More than 20 years ago, hantaviral antigens were reported in tissues of the Eurasian common
shrew (Sorex araneus), Eurasian ... of hantavirus
antigens in S. araneus in the former Yugoslavia and Russia
[15-17]. The important distinction is that we now have
sequence data to substantiate th...
Báo cáo hóa học: " Carlow Virus, a 2002 GII.4 variant Norovirus strain from Ireland" pot
... (4436–4455) -
5090 R TCATTCGACGCCATCTTCATT (5084–5104) -
4290 F TCACTATGATGCTGATTACTC (4282–4302) -
NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) +
NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) -
Virology ... V 540
AAD40497 480 P A 539
AAT12693 480 P A 539
AAD40488 480 P A 539
AAT12696 480 P A 539
AAL79839 480 P A 539
AAL18876 480 P A 539
AAT12689 480 P A 539
AAT1268...
Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf
... TPM-
M-F1 (5'-TAGTAGTAGACTCCGCA-3) and TPM-M-R3684
(5'-TAGTAGTATRCTCCGCARG-3), and HANTA-L-F2, (5'-
TAGTAGTAGACTCCGGAAG-3') and HANTA-L-R6577
(5'-TAGTAGTATGCTCCGRGAA-3') ... associated
with infection by Murinae- and Arvicolinae-associated
hantaviruses (e.g. Hantaan, Seoul and Puumala viruses)
and hantavirus pulmonary syndrome (HPS) is associated
with Sigmodonti...
báo cáo hóa học: " Validation of a French language version of the Early Childhood Oral Health Impact Scale (ECOHIS)" ppt
... impact increasing
by age.
In examining the internal consistency of the French ECO-
HIS, using data from the community-based sample, we
found Cronbach's alpha values of 0.79 and 0.79 for the
child ... citation purposes)
lated using the INTRACC macro in SAS was used to evalu-
ate test-retest reliability.
All data analyses were performed using the SAS program
(SAS 7.0).
Resu...
báo cáo hóa học:" Characteristics of non-AIDS-defining malignancies in the HAART era: a clinico-epidemiological study" doc
... SDW
participated in the study design, data analysis, and writing of the paper. MD
extracted the data, and performed part of the statistical analysis. VCN
encoded the data, and was in charge of the cohort. ... Wit
*
, Marc Delforge, Valentina Coca Necsoi and Nathan Clumeck
Abstract
Background: Non-AIDS-defining malignancies (NADM) are becoming a major cause of mortality in...
báo cáo hóa học:" Medication quality and quality of life in the elderly, a cohort study" doc
... contributions
INO participated in the design of the study, the statistical analysis and the
drafting of the manuscript. RR participated in the statistical analysis and the
drafting of the manuscript. PE participated ... participated in the design of the study and
the drafting of the manuscript. All authors read and approved the final
manuscript.
Competing inter...
Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx
... If no data have been relayed within the allowed
waiting time, the system generates a new packet which
combines all parameters that have the same destination.
As a result, information exchanges ... can associate metadata with, or r etrieve
metadata from, stored packets using the packet facade. b Only the packet facade requires knowledge about the packet format. As long as the...
Báo cáo hóa học: " Research Article A Salient Missing Link in RFID Security Protocols" potx
... attack model and will be a basis for many
RFID authentication protocols that are vulnerable to the
attack.
3. The Timing Attack
Timing attacks provide an attacker with secrets maintained
in a security ... and each T and may make any ReaderInit
or TagInit calls in any interleaved order without
exceeding its parameter bounds.
(2) Challenge Phase. in this phase, the adversary A...
Từ khóa: