Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx

... design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR per- forming experiments; JC Luminex data analysis and inter- pretation. PK and HSJ data interpretation; ... citation purposes) Virology Journal Open Access Short report Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly...

Ngày tải lên: 20/06/2014, 01:20

... took an alternative approach to explore the relative importance and role that different cytokines and chemokines play in acute RSV disease sever- ity. Instead of targeting individual cytokines as ... before virus inoculation. Bronchoalveolar lavage (BAL) and serum samples were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex a...

Ngày tải lên: 18/06/2014, 18:20

... with a standardized and coordinated international information sharing is crucial for the management not only for pandemic influenza but all pandemics [22]. The setting of standards for coping Figure ... for swine flu (36.3%), and seasonal influenza (40.5%), than the average annual uptake of the influenza vaccine in the German health care system (approximately 22%). Neverthel...

Ngày tải lên: 20/06/2014, 00:20

... socio-demo- graphic and occupational characteri stics was conducted, using means and standard deviations for age and per- centages for the other variables. Contrasts were made depending on the sub-sample ... Petros Skapinakis 3,4 , Ricardo Araya 3 , Margarita Gili 5 and Javier Garc a- Campayo 1* Abstract Background: Burnout has traditionally been described by means of the dime...

Ngày tải lên: 20/06/2014, 15:20

... painful or painless, strokes can be mild or severe, and myocardial infarctions can be large and complicated or small and uncomplicated. The way the investigators present the results of clinical ... [46]. The third approach evaluates the score change in relation to measurement precision. Examples include standard error of the mean [47] and a reliable change index [48]....

Ngày tải lên: 20/06/2014, 16:20

... postulates that a progression from chronic gastritis to gastric atrophy, intestinal metaplasia (IM), dysplasia, and finally to cancer ('gastritis-dysplasia-carcinoma' sequence) [14]. In ... method. Clinical parameters, International Union Against Cancer (UICC) TNM stage, cancer size, differentiation or lymphatic invasion, vascular or perineural invasion and prognosis were us...

Ngày tải lên: 18/06/2014, 15:20

... especially the pallidum and the subthalamic nucleus, but are mainly synchronized by cortical activity via the striatal inputs. There is an abnormal coupling between the EMG of fore- arm muscles and ... loops has specific anatomical con- nections, inherent time delays, adaptable gains and interacts with a myriad of sensory feedback signals [5]: -the loop between motor corte...

Ngày tải lên: 18/06/2014, 15:20

... kanomasa@sapmed.ac.jp; Takuro Wada - twada@sapmed.ac.jp; Mitsunori Kaya - mkaya@sapmed.ac.jp; Satoshi Nagoya - nagoya@sapmed.ac.jp; Toshihiko Yamashita - tyamasit@sapmed.ac.jp; Noriyuki Sato - nsatou@sapmed.ac.jp * ... Kawaguchi* - kawaguch@sapmed.ac.jp; Toshihiko Torigoe - torigoe@sapmed.ac.jp; Akari Takahashi - atakahashi@sapporo.jst-plaza.jp; Masaki Murase - murasem@sapmed.ac.jp; Masano...

Ngày tải lên: 18/06/2014, 15:20

... vinblastine, dacarbazine, interleukin-2, and interferon alfa-2b with cisplatin, vinblastine, and dacarbazine alone in patients with metastatic malignant melanoma (E3695): a trial coordinated ... comparing the response rates of carmustine, dacarbazine, and cisplatin with and without tamoxifen in patients with metastatic melanoma. National Cancer Institute of Canada Clinica...

Ngày tải lên: 18/06/2014, 16:20

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... can elevate fetal hemo- globin have great potential as therapeutic agents. The DNA methyltransferase (DNMT) inhibitors 5-azacytidine and 5-aza-2’deoxycyidine (decitabine) have been...

Ngày tải lên: 18/06/2014, 16:20