Báo cáo hóa học: " A pandemic strain of calicivirus threatens rabbit industries in the Americas" doc
Báo cáo hóa học: " A pandemic strain of calicivirus threatens rabbit industries in the Americas" doc
... apparent that a selective advantage, perhapsdriven by the vaccine strain being of the original RHDVserotype, is driving the fixation of the RHDVa epitope in nature.Conclusion In summary, the ... state of Indiana. Other outbreaks in the Americas include Mexico in 1988 and more recently, in 2004, Uruguay and Cuba.As with other RHDV isolates in Europe and Asia, the Indi-ana RHDV isolate was ... death in 70% to 95% of infected animals. There have been four separateincursions of RHDV in the USA, the most recent of which occurred in the state of Indiana in June of 2005. Animal inoculation...
- 13
- 381
- 0
Báo cáo sinh học: " A pandemic strain of calicivirus threatens rabbit industries in the Americas" pdf
... from China, and phylogenetic analysis of the major capsid protein (VP60) revealedthat they were related to a pandemic antigenic variant strain known as RHDVa. Rapid spread of the RHDVa pandemic ... JournalOpen AccessResearch A pandemic strain of calicivirus threatens rabbit industries in the AmericasMichael T McIntosh*1, Shawn C Behan1, Fawzi M Mohamed1, Zhiqiang Lu2, Karen ... primer:GGCCACGCGTCGACTAGTAC and a conserved forwardprimer 3PForRHD: AGTGTTAAGATTTATAATACC. The 5'end of UT-01, NY-01, IN- 05, and ITALY-90 were obtainedby the 5' RACE. Random primed cDNA was tailed...
- 13
- 639
- 0
báo cáo hóa học:" A comparative study of some methods for color medical images segmentation" doc
... medical images is the task of partitioning the data intocontiguous regions representing individual anatomical objects. This task plays a vital role in many biomedical imaging applications: the ... abouttypical shape and image data characteristics. But, manual segmentation is a very time-consuming process for the already increasing amount of medicalimages. As a result, reliable automatic methods ... that the values for GCEand LCE are lower in the case of hexagonal segmentation. The error measures,for almost all tested images, have smaller values in the case of the original seg-mentation...
- 42
- 414
- 0
báo cáo hóa học:" A comprehensive review of 46 exercise treatment studies in fibromyalgia (1988–2005)" ppt
... thatthere was a natural break in the data at a certain number of classes. This is problematic in that the "dose" of the intervention was not generally attainable.Outcome measures The ... Landewe R, van der Linden S: A randomizedclinical trial comparing fitness and biofeedback training ver-sus basic treatment in patients with fibromyalgia. J Rheumatol2002, 29:575-81.59. van ... of a drug and exercise(amitriptyline and pyridostigmine). Four used movementtherapies (e.g. T'ai Chi, QiGong, balneotherapy, thalasso-therapy). We acknowledge that other therapies using...
- 6
- 455
- 0
Báo cáo hóa học: " A case study of GM maize gene flow in South Africa" potx
... analysis and draft and final manuscript preparation. LC participated in the design of the study, data collection and analysis, primary data analysisand draft manuscript preparation.Competing interests The ... transformation of the cross-pollinationdata revealed a linear correlation between mean cross-pollination over distance at individual sites (data notprovided) as well as combined data over all ... espe-cially, since in recent years, there have been severalexamples of unwanted commingling. Examples of theseinclude the detection of transgenes in landraces in Mexico [ 6], the introgression of...
- 8
- 452
- 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... 1,wherematrixS(τJ)isconstructedinawaysimilar to S(τ) based on the already estimated path delays. The value of the search step size δ a ects the estima-tion accuracy of the maximization procedure. In any case, the estimates ... R−1η−R−1ηS(P−1)(SH(P−1)R−1ηS(P−1))−1SH(P−1)R−1ηat the beginning of each step, that is, at the beginning of the line search for a de-lay parameter. Without taking into consideration the blockdiagonal form of Rη, as well as the order ... the main diagonal elements of Rη.Hence, the MAI covariance matrix Rηcan be approximatedas a block diagonal matrix and the block that appears in itsmain diagonal is given by (A. 4).Notethatsuchanapprox-imation...
- 12
- 438
- 0
Báo cáo hóa học: " An international evaluation of ultrasound vs. computed tomography in the diagnosis of appendicitis" doc
... conceived of the study from the United States standpoint, participated in the design of the study, performed the statistical analysis, and participated in the drafting of the manuscript. Allauthors ... calculate that a “first pass”approach of using US first, and then performing a confirmatory CT scan in patients with negative US, would havesaved an average of 88.0 minutes per patient in the ... were available on Soarian (Siemens Medical Solu-tions, Malvern, PA). Of note, the data abstractor had for-mal medical training and was fluent in both Hebrew andEnglish.Ultrasound examinationColor...
- 7
- 451
- 0
báo cáo hóa học:" A biomechanical assessment of modular and monoblock revision hip implants using FE analysis and strain gage measurements" potx
... (i.e. they easily peel orshear off) and the confined space inside the canal (i.e.there is little room to accommodate strain gage wiring). In spite of these drawbacks, the main intention of thisstudy ... Construct A to validate the FE model. Strain gages were placed along the medial and lateral side of the hip implants at 8 locations to measure axial strain distribution.Results: There was approximately ... 5:34http://www.josr-online.com/content/5/1/34Page 12 of 12thank Kaveh Aminvaziri and Hooman Nouraei for drafting initial three-dimen-sional geometries of the implants.Author Details1Department of Mechanical and Industrial Engineering,...
- 12
- 333
- 0
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx
... (β2m), 5'-TAT-AGTCGACCACCCGGACTCAGAATCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA -A) ,5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' ... and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA-B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT-GCCAATCTCATCTT-3' (β-Actin), 5'-CTGAAGGAGAC-CATTGGTGA and 5'-GGTACTGGTACACAGTTCGA-3'(CD45). ... (forward and reverse, TAP1), 5'-GTACAACACCCGCCATCAG-3' and 5'-GGACGTAGGG-TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT-3' and 5'-AAGACCAGTCCTTGCTGA-3'...
- 13
- 529
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... Medical College of Wisconsin, Milwaukee, WI, USA and 4Section on Statistical Genetics, Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL, USAEmail: Julie A Panepinto* ... isunclear whether the Family Impact Module is a valid andreliable measure for assessing the impact of SCD on par-ents and families. We therefore analyzed the followingproperties of the PedsQL™ Family ... alpha for each of the 8 subscales of the PedsQL™ Family Impact Module as wellas for the summary and total scores. A Cronbach's alphacoefficient of greater than 0.70 was considered acceptablefor...
- 11
- 552
- 0
Từ khóa: when the carrying amount is a reasonable approximation of fair value for example in the case of non current trade receivables and payablesneeded—a dynamic source of motivation for jewish life in the diasporabáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quotbài báo cáo môn học hóa vô cơ nâng caoBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)