Báo cáo hóa học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx

Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx

... psychiatry, and the KINDL for more extensive and broad assessment of QoL in children. The primary aims of the study were to compare child and parent by proxy ratings of child QoL and to investigate factors ... results of an analysis of unconditional random effects showed that only 3.6% of the total variance of the ILC LQ0-28 scores and 6.5% of the total KINDL Total...

Ngày tải lên: 18/06/2014, 22:20

11 568 0
báo cáo hóa học: " Inhibition of secreted phospholipase A2 by neuron survival and anti-inflammatory peptide CHEC-9" docx

báo cáo hóa học: " Inhibition of secreted phospholipase A2 by neuron survival and anti-inflammatory peptide CHEC-9" docx

... period and the samples obtained via a tail nick. All specific pro- cedures of this study were approved by both the Institu- tional Animal Care and Use Committee and by Institutional Review Board of ... analysis and wrote the manuscript. All authors contributed to design of the experiments and interpreta- tion of data, and trouble-shooting the specific procedures involv...

Ngày tải lên: 19/06/2014, 22:20

9 293 0
Báo cáo hóa học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

Báo cáo hóa học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

... activities of Vps4A and Vps4B are clearly required for efficient budding of HTLV-1. DN form of AIP1/Alix suppresses the egress of the HTLV-1 VLP production To examine the involvement of AIP1/Alix in HTLV-1 ... class E proteins Vps4A, Vps4B, and AIP1 (Fig. 1). The results indicated that the catalytic activities of Vps4A and Vps4B are required for budding of...

Ngày tải lên: 20/06/2014, 01:20

5 309 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

... 1 of 5 (page number not for citation purposes) Virology Journal Open Access Research Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix Shuzo Urata 1,2,3 , Hideyoshi Yokosawa 3 and ... mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins. Results: Here, we report that DN for...

Ngày tải lên: 18/06/2014, 18:20

5 303 0
báo cáo hóa học:" Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

báo cáo hóa học:" Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

... presence of an antibody to c-Myb con- firmed the presence of c-Myb in the specific DNA-protein Regulation of FeLV replication in response to exogenous overexpression of CBPFigure 7 Regulation of FeLV ... (5'-GAACTCTGGTCAACT- GGGGAGCCTGGAGACTGCTG-3') and the Klenow frag- ment of DNA polymerase. The resulting double stranded oligonucleotides were digested with AluI/H...

Ngày tải lên: 20/06/2014, 04:20

10 254 0
báo cáo hóa học:" Regulation of microRNA biosynthesis and expression in 2102Ep embryonal carcinoma stem cells is mirrored in ovarian serous adenocarcinoma patients" pdf

báo cáo hóa học:" Regulation of microRNA biosynthesis and expression in 2102Ep embryonal carcinoma stem cells is mirrored in ovarian serous adenocarcinoma patients" pdf

... differen- tiation status is confirmed by decreases in expression of Oct4 and Nanog and increases in expression of Afp, Ncam1 and Eno3. 2102Ep cells alter expression of these genes less than two-fold, ... confirmed by decreased expression of pluripotency markers Oct4 and Nanog and increased expression of differentiation markers Ncam1, Eno3 and Afp (Figure 4). While...

Ngày tải lên: 20/06/2014, 07:20

16 291 0
Tài liệu Báo cáo khoa học: Regulation of cathepsin B activity by 2A2 monoclonal antibody docx

Tài liệu Báo cáo khoa học: Regulation of cathepsin B activity by 2A2 monoclonal antibody docx

... the binding of substrates and other inhibitors and to iden- tify the mechanism by which it regulates the activity of cathepsin B. Results Preparation and characterization of 2A2 mAb and its Fab ... (2005) Develop- ment and regulation of monoclonal antibody products: challenges and opportunities. Cancer Metastasis Rev 24, 569–584. 28 Kimby E (2005) Tolerability and sa...

Ngày tải lên: 18/02/2014, 11:20

13 417 0
Báo cáo khoa học: Regulation of translational efficiency by different splice variants of the Disc large 1 oncosuppressor 5¢-UTR potx

Báo cáo khoa học: Regulation of translational efficiency by different splice variants of the Disc large 1 oncosuppressor 5¢-UTR potx

... levels of DLG1 mRNA and spe- cific DLG1 primers (3¢-DLG Outer and 3¢-DLG Inner) as described in Materials and methods. These reactions yielded two bands of  150 and 250 bp as detected by gel ... presence of the uORF in the 5¢-UTR CTTTTCCCCGGTGGGGATCTACCCCCGGGGTCGCCAGGCGCTGTCTCTGCCGCGGAGTTGGAAA CGGCACTGCTGAGTGAGGTTGAGGGGTGTCTCGGTATGTGCGCCTTGGATCTGGTGTAGGCGAG GTCACGCCTCTCTTCAG...

Ngày tải lên: 22/03/2014, 16:20

13 332 0
Báo cáo Y học: Regulation of mammalian translation factors by nutrients pot

Báo cáo Y học: Regulation of mammalian translation factors by nutrients pot

... that the regulation of the activity of eIF2B, rather than the control of 4E-BP1 (or by implication, S6K1), is important for the overall regulation of protein synthesis in these cells. Control of 4E-BP1 ... accumulation of uncharged tRNA, to activation of the eIF2a kinase GCN2 and phosphorylation of eIF2. eIF2(aP) acts a potent inhibitor of eIF2B and thus also of...

Ngày tải lên: 23/03/2014, 21:20

12 360 0
báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

... both memory and naïve B cells, as demonstrated by upregulation of CD86, CD70, CD40, and MHC class I and II. CP-870,893-activated B cells induced T cell proliferation and T cell secretion of effector ... both memory and naïve B cells can be activated by the drug CP-870,893, and this CP- 870,893 effect can be increased by the addition of CpG ODN 2006. Naïve B cells, as d...

Ngày tải lên: 18/06/2014, 15:20

10 624 0
w