... AAR97 645 48 1 540 AAT002 34 481 540 AAT00327 48 1 540 AAR97663 48 1 540 AAS89 040 48 1 540 AAT00339 48 1 540 AAT00 249 48 1 T 540 AAR97651 48 1 540 AAT00 348 48 1 540 AAR32988 48 1 540 ABC96 746 48 1 A 540 ... [29] ORF3minusdegen ATCTCCTTRTCATGWTTRAARGAAGCC (6868–68 94) - 43 0F ATGTGGGAYGGRGAGATCTAC (398 41 8) + 44 40 minus TCGTTGATTGATATTGTGAAGTC (44 36 44 58) - 4...
Ngày tải lên: 20/06/2014, 01:20
... AAT00 249 48 1 T 540 AAR97651 48 1 540 AAT00 348 48 1 540 AAR32988 48 1 540 ABC96 746 48 1 A 540 BAF38397 48 0 P A 539 AAL18873 48 1 Y P V 540 AAD4 049 7 48 0 P A 539 AAT12693 48 0 P A 539 AAD4 048 8 ... TTGATTGATATTGTGAAGTC (44 36 44 55) - 5090 R TCATTCGACGCCATCTTCATT (50 84 51 04) - 42 90 F TCACTATGATGCTGATTACTC (42 82 43 02) - NLV1S25F GTGAATGAAGATGGCGTCTAACGAC...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus)" pdf
... and T-M 148 5R: 5'-CCAGCCAAARCARAATGT-3', then T- M1199F: 5'-TAAVTTCAMCAAC ATGTCT-3' and T- M 148 5R for the M segment; and OSM55 and T-L 145 4R: 5'-ATGCCC WATATGCCATGC-3', ... then OSM55 and T- L390R: 5'-GTCACWGTRACCTC-3', MJN L181F: 5'-ATGA- GATGATAAARCATGA-3' and T-L 145 4R, SWS L1351F and PHL 344 5R: 5'-GRTTAAACATACTCTTCCTCCACATCTC- 3...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Frag-Virus: a new term to distinguish presumptive viruses known primarily from sequence data" pdf
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: "Research Article A Dependent Multilabel Classification Method Derived from the k-Nearest Neighbor Rule" ppt
... measures the average fraction of labels 14 EURASIP Journal on Advances in Signal Processing [20] Y. Yang, “An evaluation of statistical approaches to text categorization,” Journal of Information ... learning algorithms and making them able to manipulate multilabel data dir ectly [12]. Some multilabel classification methods are briefly described below. In [13], an adaptation of the traditional...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article A Dynamic Tap Allocation for Concurrent CMA-DD Equalizers" pot
... implementation, the sparse nature of the broadcast channel suggests the use of a dynamic tap allocation (DTA) algorithm, not only as a means to reduce the equalizer complexity, but also as a means ... proposals. 2. Tap Ranking and Dynamic Allocation As in any gradient-based algorithm, the CEQ gradient trajectory wanders around the minimum of the J CMA and J DD functions as a consequen...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article A New Bigram-PLSA Language Model for Speech Recognition" potx
... language modeling. Latent topic modeling approaches such as Latent Semantic Analysis (LSA) [1, 2], Probabilistic Latent Semantic Analysis (PLSA) [3], and Latent Dirichlet Allocation (LDA) [4] ... the bigram-PLSA models an unfair advantage by allowing them to adapt the model parameters to the test data. Nevertheless, we applied it to avoid overfitting. To have a valid comparison, the PLSA and...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot
... safe state to current attacked state; (3) from previous attacked state to current safe state; and (4) from previous attacked state to current attacked state. Although the historical data obtained ... H(t s ). An example of the distance-consistent spooking attack is shown in Figure 1 (a) . As two colluding attackers A 1 and A 2 can communicate with each other via an attack link,locato...
Ngày tải lên: 21/06/2014, 11:20
báo cáo hóa học:" Research Article A Semianalytical PDF of Downlink SINR for Femtocell Networks" pot
... channel bandwidth, and ϕ is the noise figure of the MS. In order to make N bg mathematically tractable, we introduce an auxiliary Gaussian RV X n with zero mean and zero variance so that N bg can betreatedaslog-normalRVwithparametersofμ n = ln(kTWϕ)andσ n = ... N bg can betreatedaslog-normalRVwithparametersofμ n = ln(kTWϕ)andσ n = 0. Note that N bg has a constant value, and this is accounted...
Ngày tải lên: 21/06/2014, 18:20
Báo cáo hóa học: " Research Article A Class of p-q-Laplacian Type Equation with Potentials Eigenvalue Problem in RN" pot
... and A. Touzani, “Nonlinear homogeneous eigenvalue problem in R N : nonstandard variational approach,” Commentationes Mathematicae Universitatis Carolinae, vol. 38, no. 3, pp. 42 1 43 1, 1997. 12 ... 341 –359, 1987. 16 A. Bahri and Y. Y. Li, “On a min-max procedure for the existence of a positive solution for certain scalar field equations in R N ,” The Revista Matem ´ atica Iberoame...
Ngày tải lên: 21/06/2014, 20:20