báo cáo hóa học:" Sevoflurane requirement during elective ankle day surgery: the effects of etirocoxib premedication, a prospective randomised study" pdf
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... 5'-CACCCAGCACAATGAAGAT-3'; ACTBreverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi-tions were used as described previously [17]: 95°C for 10min to activate DNA polymerase, followed ... ABCC2-dependingcisplatin resistance in NPC.ABCC2 siRNA increased the intracellular accumulation of cisplatinFigure 2ABCC2 siRNA increased the intracellular accumulation of cisplatin. (A) A ... Surowiak P, Materna V, Kaplenko I, Spaczynski M, Dolinska-Krajew-ska B, Gebarowska E, Dietel M, Zabel M, Lage H: ABCC2 (MRP2,cMOAT) Can Be Localized in the Nuclear Membrane of Ovarian Carcinomas...
- 9
- 509
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... combination DNA and inactivated rabies virus vaccine. HumGene Ther 2001, 12:1917-1922.32. Wang S, Parker C, Taaffe J, Solórzano A, Garc a- Sastre A, Lu S: HeterologousHA DNA vaccine prime–inactivated ... elec-troporated DNA as a boost ing agent [65]. Effectivepriming may also be achievable through intr adermaldelivery of DNA as shown in a model of human skintattooing [66].In light of the scarcity of ... [18],intra-lymphatic administration [19,20], or other enhan-cing approaches such as electroporation [21], have onlypartially improved the immune re sponse achievable byDNA vaccination alone. Nevertheless,...
- 11
- 505
- 0
báo cáo hóa học: " Different gait tasks distinguish immediate vs. long-term effects of concussion on balance control" ppt
... sagittalplane (APmax) and coronal plane (MLmax). Data fromthree to five successful trials were averaged together foreach group, day, and task to complete the statistical anal-yses.Together ... differentmediolateral CoM motion. They had reduced medi-olateral peak velocities of the CoM by day 14 and alsoreduced mediolateral separation of the CoM and CoP on day 28. Both of these indicate a conservative ... anal-yses.Together the aforementioned variables allow us to exam-ine two important aspects of dynamic balance control: a conservative adaptation to walking and the likelihood of imbalance during walking....
- 7
- 349
- 0
báo cáo hóa học: "Walking speed-related changes in stride time variability: effects of decreased speed" docx
... the accuracy of the data analyses. Study concept and design: OB, RWKand YL. Acquisition of data: YL, VD, and CA. Analysis andinterpretation of data: OB, GA, FRH, VD, RWK and CA.Drafting of the ... andCA. Study supervision: OB and RWK.All authors have read and approved the final manuscriptAdditional materialAcknowledgementsWe are grateful to the participants for their cooperation and ... s-1)Table 1: P-value of repeated measures analysis of variance (ANOVA) (n = 1280 steps) estimating the effects of a decrease in self-selected walking speed on mean value, standard deviation and...
- 6
- 303
- 0
báo cáo hóa học: "Performance adaptive training control strategy for recovering wrist movements in stroke patients: a preliminary, feasibility study" pptx
... frequency of oscillat ion of the target. For each DOF, the table stores the amplitude (A) of the target oscillations while #min, #maxare the minim um andmaximum value assumed by the angular offset ... the experimentsand the data analysis and drafted the manuscript; PMparticipated in the design of the study and carried out the experiment; PG participated in the coordination of the study and ... purposes)Each step of the staircase has a duration of 40s plus a 4srest interval, during which the harmonic motion of the target is stopped as well as the attractive force. For eachDoF, the ROM...
- 11
- 682
- 0
báo cáo hóa học: " Cytokine responses during chronic denervation" potx
... 3' primer ProbeGAPDH TCAACTACATGGTCTACATGTTCCAG TCCCATTCTCAGCCTTGACTG TGACTCTACCCACGGCAAGTTCAACGIFN-γ TCGAATCGCACCTGATCACTA GGGTTGTTCACCTCGAACTTG CATCCTTTTTTGCTTTACTGTTGCTGAGAAGIL-1β GAAAGACGGCACACCCACC ... GAAAGACGGCACACCCACC AAACCGCTTTTCCATCTTCTTCT TGCAGCTGGAGAGTGTGGATCCCAAACIL-10 CCCTCTGGATACAGCTGCG GCTCCACTGCCTTGCTTTTATT CGCTGTCATCGATTTCTCCCCTGTGATNF-α GACCCTCACACTCAGATCATCTTCT ACGCTGGCTCAGCCACTC ... sectionsControlProx1Prox2Prox1Prox2Prox1Prox2Prox1Prox2Prox1Prox2Prox1Prox2Prox1Prox2Prox1Prox20.0000.0050.010EndoneuriumEpi/perineurium0.250.50 Day 1 Day 3 Day 5 Day 7 Day 14 Day 21 Day 28 Day 35****IFN-J/GAPDH**Journal of Neuroinflammation 2005, 2:26 http://www.jneuroinflammation.com/content/2/1/26Page 7 of 11(page number...
- 11
- 278
- 0
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... Cancer 2005, 41:2355-9.19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N,Orita K: ICAM-1 expression and the soluble ICAM-1 level forevaluating the metastatic potential of gastric ... University of the Basque Country, Leioa, Bizkaia-48940, SpainEmail: Mar a Valcárcel - valcarcelcuesta@yahoo.es; Beatriz Arteta - tirtxe@euskalnet.net; Arrate Jaureguibeitia - ajaureguibeitia@pharmakine.com; ... Martínez1, Lorea Mendoza1, Francisco J Muruzabal1, Clarisa Salado1 and Fernando Vidal-Vanaclocha*2,3Address: 1Pharmakine Ltd., Bizkaia Technology Park, Derio, Bizkaia-48160, Spain, 2Basque...
- 12
- 419
- 0
Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf
... Strategies for untested antigen targets. Ifby an early Strategy, the patient can safely be treated, thenone may reasonably advance to more potent Strategieswith a rationale for safety. Further, ... USAFull list of author information is available at the end of the articleJunghans Journal of Translational Medicine 2010, 8:55http://www.translational-medicine.com/content/8/1/55Page 3 of ... propose an approach to escalating risk for patient exposures with these new immuno-gene therapy agents, termed Strategy Escalation, that accounts for the molecular and biological features of the...
- 8
- 474
- 0
Báo cáo hóa học: "DNA polymeraseh protein expression predicts treatment response and survival of metastatic gastric adenocarcinoma patients treated with oxaliplatin-based chemotherapy" pot
... collecting of the gastric carcinoma patients and drafted the manuscript.MZQ participated in the clinical data collecting and drafted the manuscript.ZHL carried out the cytotoxicity assay. HYL ... H, Masutani C,Hanaoka F, Moriya M: Translesion DNA synthesis catalyzed by human poleta and pol kappa across 1, N6-ethenodeoxyadenosine. J Biol Chem 2001,276:18717-21.23. Vaisman A, Masutani ... S, Takio K, Hanaoka F: The XPV (xeroderma pigmentosum variant)gene encodes human DNA polymerase eta. Nature 1999, 399:700-4.30. Masutani C, Araki M, Yamada A, Kusumoto R, Nogimori T, Maekawa...
- 9
- 610
- 0
báo cáo hóa học: " Associations between general self-efficacy and health-related quality of life among 12-13-year-old school children: a cross-sectional survey" potx
... contributed to the study design, statis-tical analysis, interpretation of data and revision of the manuscript. RS contributed to statistical analysis, inter-pretation of data and revision of the manuscript. ... inter-pretation of data and revision of the manuscript. Allauthors read and approved the final manuscript.Additional materialAcknowledgementsThis study was funded by Diakonova University ... linear associa-tion of subscore of health-related quality of life (HRQOL), socio-demographic variables and general self-efficacy (GSE). The data pro-vided represent the statistical analysis...
- 8
- 435
- 0
Từ khóa: báo cáo khoa họcbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ