báo cáo hóa học:" Sevoflurane requirement during elective ankle day surgery: the effects of etirocoxib premedication, a prospective randomised study" pdf
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi- tions were used as described previously [17]: 95°C for 10 min to activate DNA polymerase, followed ... ABCC2-depending cisplatin resistance in NPC. ABCC2 siRNA increased the intracellular accumulation of cisplatinFigure 2 ABCC2 siRNA increased the intracellular accumulation of cispl...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... combination DNA and inactivated rabies virus vaccine. Hum Gene Ther 2001, 12:1917-1922. 32. Wang S, Parker C, Taaffe J, Solórzano A, Garc a- Sastre A, Lu S: Heterologous HA DNA vaccine prime–inactivated ... elec- troporated DNA as a boost ing agent [65]. Effective priming may also be achievable through intr adermal delivery of DNA as shown in a model of human skin tattooing [66]. In...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Different gait tasks distinguish immediate vs. long-term effects of concussion on balance control" ppt
... sagittal plane (APmax) and coronal plane (MLmax). Data from three to five successful trials were averaged together for each group, day, and task to complete the statistical anal- yses. Together ... different mediolateral CoM motion. They had reduced medi- olateral peak velocities of the CoM by day 14 and also reduced mediolateral separation of the CoM and CoP on day 28. Both o...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: "Walking speed-related changes in stride time variability: effects of decreased speed" docx
... the accuracy of the data analyses. Study concept and design: OB, RWK and YL. Acquisition of data: YL, VD, and CA. Analysis and interpretation of data: OB, GA, FRH, VD, RWK and CA. Drafting of the ... and CA. Study supervision: OB and RWK. All authors have read and approved the final manuscript Additional material Acknowledgements We are grateful to the participants for their...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: "Performance adaptive training control strategy for recovering wrist movements in stroke patients: a preliminary, feasibility study" pptx
... frequency of oscillat ion of the target. For each DOF, the table stores the amplitude (A) of the target oscillations while # min , # max are the minim um and maximum value assumed by the angular offset ... the experiments and the data analysis and drafted the manuscript; PM participated in the design of the study and carried out the experiment; PG participated...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Cytokine responses during chronic denervation" potx
... 3' primer Probe GAPDH TCAACTACATGGTCTACATGTTCCAG TCCCATTCTCAGCCTTGACTG TGACTCTACCCACGGCAAGTTCAACG IFN-γ TCGAATCGCACCTGATCACTA GGGTTGTTCACCTCGAACTTG CATCCTTTTTTGCTTTACTGTTGCTGAGAAG IL-1β GAAAGACGGCACACCCACC ... GAAAGACGGCACACCCACC AAACCGCTTTTCCATCTTCTTCT TGCAGCTGGAGAGTGTGGATCCCAAAC IL-10 CCCTCTGGATACAGCTGCG GCTCCACTGCCTTGCTTTTATT CGCTGTCATCGATTTCTCCCCTGTGA TNF-α GACCCTCACACTCAGATCATCTTCT...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... Cancer 2005, 41:2355-9. 19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N, Orita K: ICAM-1 expression and the soluble ICAM-1 level for evaluating the metastatic potential of gastric ... University of the Basque Country, Leioa, Bizkaia-48940, Spain Email: Mar a Valcárcel - valcarcelcuesta@yahoo.es; Beatriz Arteta - tirtxe@euskalnet.net; Arrate Jaureguibeitia - ajau...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf
... Strategies for untested antigen targets. If by an early Strategy, the patient can safely be treated, then one may reasonably advance to more potent Strategies with a rationale for safety. Further, ... USA Full list of author information is available at the end of the article Junghans Journal of Translational Medicine 2010, 8:55 http://www.translational-medicine.com/content/8/1/5...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "DNA polymeraseh protein expression predicts treatment response and survival of metastatic gastric adenocarcinoma patients treated with oxaliplatin-based chemotherapy" pot
... collecting of the gastric carcinoma patients and drafted the manuscript. MZQ participated in the clinical data collecting and drafted the manuscript. ZHL carried out the cytotoxicity assay. HYL ... H, Masutani C, Hanaoka F, Moriya M: Translesion DNA synthesis catalyzed by human pol eta and pol kappa across 1, N6-ethenodeoxyadenosine. J Biol Chem 2001, 276:18717-21. 23. Vaisman A,...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Associations between general self-efficacy and health-related quality of life among 12-13-year-old school children: a cross-sectional survey" potx
... contributed to the study design, statis- tical analysis, interpretation of data and revision of the manuscript. RS contributed to statistical analysis, inter- pretation of data and revision of the manuscript. ... inter- pretation of data and revision of the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements This study was...
Ngày tải lên: 18/06/2014, 19:20