báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... real-time quantification RT-PCR detection of type X collagen mRNAGene Primer Sequence Type X collagen Forward 5'-AGTGCTGTCATTGATCTCATGGA-3'Reverse 5'-TCAGAGGAATAGAGACCATTGGATT-3'18S ... Orthopaedic Surgery and ResearchOpen AccessResearch article Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative studyXu Yang†, Peter ... results in an increase of Col X mRNA expression. Such quantitative analysis hasimportant implications for our understanding of mechanosensitivity of cartilage and mechanicalregulation of chondrocyte...
- 10
- 546
- 0
Báo cáo hóa học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" pptx
... change expression patterns of the other KC differentia-tion markers by reducing expression of basal keratins K14and increasing expression of keratins K1 and K10 (datanot shown). These data indicate ... Research Extension, Building 1, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, AustraliaEmail: Xiao Wang - xxxwang1@uq.edu.au; Bo Li - uqbli3@uq.edu.au; Kong-Nan Zhao* - k.zhao@uq.edu.au* ... h and harvested for analysis of L1 gene expression. (A) . L1 transcripts were assessed by quantitative RT-PCR. β-tubulin transcript was analysed as an internal control. Up panel: Representative...
- 6
- 331
- 0
báo cáo hóa học:" Differential expression of aldehyde dehydrogenase 1a1 (ALDH1) in normal ovary and serous ovarian tumors" docx
... n, staining of the surfaceepithelium was patchy compared to normal ovary (Fig-ure 3A) and contained areas of intense staining adjacentto areas of no staining (Figure 4D - 4F). In malignant ... (5’-CTGTGGCATCCACGAAACTA-3’ )andReverse (5’- ACATCTGCTGGAAGGTGGAC -3’). ThePCR amplifications were carried out in a 25 μl reactionvolume containing 25 ng of cDNA using Platinum TaqDNA Polymerase (Invitrogen) ... ALDH1 in ovarian cancer, we examined ALDH1 expression andlocalization in normal ovary and ovarian tumors in order to determine if ALDH1 expression is altered, ifthe cell types expressing ALDH1...
- 13
- 398
- 0
báo cáo hóa học:" Kidney function of HIV-infected children in Lagos, Nigeria: using Filler’s serum cystatin C-based formula" docx
... means of the plasmaclearance of cystatin C [10 ,18]. HIV infection, by indu-cing a glomerulopathy (as exemplified in HIV-associatednephropathy), results in a reduction in the plasma clear-ance ... White C, Akbari A, Hussain N, Dinh L, Filler G, Lepage N, Knoll GA:Estimating glomerular filtration rate in kidney transplantation: a comparison between serum creatinine and cystatin C-based methods. ... Baxmann AC, Ahmed MS, Marques NC, Menon VB, Pereira AB, Kirsztajn GM,Heilberg IP: Influence of muscle mass and physical activity on serum andurinary creatinine and serum cystatin C. Clin J Am...
- 8
- 370
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... [8] indicate that its alanine-glyoxylate aminotransferase activity is not favoredover aminobutyrate-pyruvate, b-alanine-pyruvate anddimethylarginine-pyruvate aminotransferase activities. In ... Agt), alanine-glyoxylateaminotransferase knockout; Aldh2, aldehydedehydrogenase 2; Car3, carbonic anhydr-ase 3; Cat, catalase; Dao1,D-amino acidoxidase 1; Eno1, enolase 1, a non-neuron;Fah, ... catalase(Cat-L), enolase (Eno1-L), alanine-glyoxylateaminotransferase (Agt-L), actin (Actin-L) andglyoxylate reductase ⁄ hydroxypyruvatereductase (Grhpr-L) from liver. (B) Westernblot analyses...
- 9
- 481
- 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R)12 reverse CAAGGAGCGTTAGAATCTAAAG H1R13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R)14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R7 both forward CAGAAAAAGACAAGGAGGAC F19RIsoform-specific ... & PCR 1 both forward GTGGACGTGATGGAGGATAAG A1 F 728 (with A1 F and A1 R)2 reverse GAAGGCACGCTGAGGAAGAC A1 R5’-RACE 3 both outer reverse GGATGAATGCCCAACTTCTCCC B13R4 both outer reverse ACGAAACCTGGCAGAGTCCAAG...
- 11
- 662
- 0
Báo cáo khoa học: Differential expression of endogenous sialidases of human monocytes during cellular differentiation into macrophages potx
... theplasma membrane. Biochem J 349, 343–351.14 Miyagi T, Wada T, Iwamatsu A, Hata K, YoshikawaY, Tokuyama S & Sawada M (1999) Molecular cloningand characterization of a plasma membrane-associatedsialidase ... immunoprecipitation of the Neu1-containing multienzyme complex that also containsb-D-galactosidase and cathepsin A, the depleted lysate was assayedfor b-galactosidase (GAL), b-hexosaminidase (HEX), and sialidaseactivities ... (1996) Association of N-acetyl-galactosamine-6-sulfate sulfatase with themultienzyme lysosomal complex of b-galactosidase,cathepsin A and neuraminidase: possible implication forintralysosomal catabolism...
- 12
- 322
- 0
báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx
... upregu-lated in glioblastoma (GBM) compared to anaplastic astrocy-toma (Astro), anaplastic oligodendroglioma (Oligo) and mixed glioma, anaplastic oligoastrocytoma (Mix). The mean expression ... signature to examinethe activation status of TGFβ in high-grade gliomas usingpublished microarray data.MethodsGlioma microarray datasetsTwo glioblastoma microarray datasets were used in thisstudy: ... view of TGFβ activation in a largecohort of human glioma patients. In this study, weadopted an alternative approach. By examining the tran-scriptional responses induced by TGFβ activation in...
- 11
- 659
- 0
Báo cáo hóa học: " Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032" potx
... the ability of PLX4032 to differentially blockMAPK pathway signaling in a panel of human melanomacell lines (Table 1) by quantitating the inhibition of phos-phorylated Erk (pErk), a downstream ... Toward a molecular classification of melanoma. J Clin Oncol 2007, 25:1606-1620.6. Haluska FG, Tsao H, Wu H, Haluska FS, Lazar A, Goel V: Genetic alterations in signaling pathways in melanoma. ... knowledge of the oncogenic events in mela-noma indicates that a majority of mutations activate themitogen-activated protein kinase (MAPK) pathway [1,2].The most frequent mutation in the MAPK pathway...
- 11
- 448
- 0
Báo cáo hóa học: " High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma" doc
... multivariate analysis of different prognostic factors in 123 patients with hepatocellularcarcinoma (Cox Proportional Hazards Regression)Univariate analysis Multivariate analysisVariable All cases ... K, Yamakawa M, Semba S, Takeda H, Kawata S, Kimura S,Kimura W: Expression of HDAC1 and CBP/p300 in human colorectalcarcinomas. J Clin Pathol 2007, 60:1205-1210.22. Karamouzis MV, Konstantinopoulos ... Lau WY, Lai EC: Hepatocellular carcinoma: current management andrecent advances. Hepatobiliary Pancreat Dis Int 2008, 7:237-257.31. Bruix J, Sherman M: Management of hepatocellular carcinoma....
- 11
- 425
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ