báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... real-time quantification RT-PCR detection of type X collagen mRNA Gene Primer Sequence Type X collagen Forward 5'-AGTGCTGTCATTGATCTCATGGA-3' Reverse 5'-TCAGAGGAATAGAGACCATTGGATT-3' 18S ... Orthopaedic Surgery and Research Open Access Research article Differential expression of type X collagen in a mechanically active 3-D chondrocyte...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Differential expression of papillomavirus L1 proteins encoded by authentic and codon modified L1 genes in methylcellulose-treated mouse keratinocytes" pptx
... change expression patterns of the other KC differentia- tion markers by reducing expression of basal keratins K14 and increasing expression of keratins K1 and K10 (data not shown). These data indicate ... Research Extension, Building 1, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, Australia Email: Xiao Wang - xxxwang1@uq.edu.au; Bo Li - uqbli3@uq.edu.au; Kong-Nan...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Differential expression of aldehyde dehydrogenase 1a1 (ALDH1) in normal ovary and serous ovarian tumors" docx
... n, staining of the surface epithelium was patchy compared to normal ovary (Fig- ure 3A) and contained areas of intense staining adjacent to areas of no staining (Figure 4D - 4F). In malignant ... (5’-CTGTGGCATCCACGAAACTA-3’ )and Reverse (5’- ACATCTGCTGGAAGGTGGAC -3’). The PCR amplifications were carried out in a 25 μl reaction volume containing 25 ng of cDNA using Platinum Taq D...
Ngày tải lên: 20/06/2014, 07:20
báo cáo hóa học:" Kidney function of HIV-infected children in Lagos, Nigeria: using Filler’s serum cystatin C-based formula" docx
... means of the plasma clearance of cystatin C [10 ,18]. HIV infection, by indu- cing a glomerulopathy (as exemplified in HIV-associated nephropathy), results in a reduction in the plasma clear- ance ... White C, Akbari A, Hussain N, Dinh L, Filler G, Lepage N, Knoll GA: Estimating glomerular filtration rate in kidney transplantation: a comparison between serum creatinine and...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... [8] indicate that its alanine- glyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities. In ... Agt ) , alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydr- ase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; F...
Ngày tải lên: 23/03/2014, 03:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... &...
Ngày tải lên: 19/02/2014, 02:20
Báo cáo khoa học: Differential expression of endogenous sialidases of human monocytes during cellular differentiation into macrophages potx
... the plasma membrane. Biochem J 349, 343–351. 14 Miyagi T, Wada T, Iwamatsu A, Hata K, Yoshikawa Y, Tokuyama S & Sawada M (1999) Molecular cloning and characterization of a plasma membrane-associated sialidase ... immunoprecipitation of the Neu1-containing multienzyme complex that also contains b- D-galactosidase and cathepsin A, the depleted lysate was assayed for b-galactosidase...
Ngày tải lên: 16/03/2014, 19:20
báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx
... upregu- lated in glioblastoma (GBM) compared to anaplastic astrocy- toma (Astro), anaplastic oligodendroglioma (Oligo) and mixed glioma, anaplastic oligoastrocytoma (Mix). The mean expression ... signature to examine the activation status of TGFβ in high-grade gliomas using published microarray data. Methods Glioma microarray datasets Two glioblastoma microarray datasets were used i...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032" potx
... the ability of PLX4032 to differentially block MAPK pathway signaling in a panel of human melanoma cell lines (Table 1) by quantitating the inhibition of phos- phorylated Erk (pErk), a downstream ... Toward a molecular classification of melanoma. J Clin Oncol 2007, 25:1606-1620. 6. Haluska FG, Tsao H, Wu H, Haluska FS, Lazar A, Goel V: Genetic alterations in signaling path...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma" doc
... multivariate analysis of different prognostic factors in 123 patients with hepatocellular carcinoma (Cox Proportional Hazards Regression) Univariate analysis Multivariate analysis Variable All cases ... K, Yamakawa M, Semba S, Takeda H, Kawata S, Kimura S, Kimura W: Expression of HDAC1 and CBP/p300 in human colorectal carcinomas. J Clin Pathol 2007, 60:1205-1210. 22. Karamouzis MV,...
Ngày tải lên: 18/06/2014, 16:20