báo cáo hóa học:" Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study" pdf
báo cáo hóa học:" Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study" pdf
... Access Research Shiftwork in the Norwegian petroleum industry: overcoming difficulties with family and social life – a cross sectional study Cathrine Haugene Ljoså* and Bjørn Lau Address: National ... citation purposes) with having enough time to be with friends and to main- tain adequate social relations. Further, wishful thinking as a coping s...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf
... studies in young adult animals also demonstrate that DE elevates pro- inflammatory factors in the brain, using a month-long inhalation models [18,28], in tratracheal administration directly into the ... IL-1β: Interleukin 1 beta; IL-6: Interleukin 6; MIP-1α: Macrophage inflammatory protein 1 alpha; NAAQS: National Ambient Air Quality Standards; A : Beta Amyloid; FTD: Frontotempor...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx
... deficits and rotarod performance. AGF and MGC performed the calculation of the infarct volumes and participated in the statistical analysis of the data. OSL, EM and BLF partici- pated in the design and coordination ... brain section was defined as infarcted. Cortical and subcortical uncorrected infarcted areas and total hemispheric areas were calcu- lated separatel...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx
... all the plant work. PAR and PC did the RNA extractions, labeling and microarray hybridizations. MAPA analyzed the microarray data and supervised microarray work. JC, GR and AJ developed the algorithm and ... deprivation and ABA-mediated signaling share six genes. Three of them were ABA-activated transcription factors (At4g34000, At2g46680 and At1g45249), At4g33950 is an...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda" docx
... AF364055 GCCCCTGCCATTTGAAAAAT TCGCGAATGCAGTAGCACTG rep4 AY499565 CGGCGTGTCACAAACTGTTG GCTTCAAGATGTTGCCCCATT rep5 AY499566 GGAAGACCGCCTGCTTATCA CCTCCGAATAAAGGCGTCAGT rep6 AY499567 AAGGCCAGAAGAAGATCGCC AGAGGCATGAGCCAGTCCC rep7 ... AF479654 GGGTCGCAATGAAGGTGCTA CTGGCGAGTGTGTTTGCAAT H. didymator 18S RNA AY433942 CATCGTGGTGCTCTTCATTGA CAAAGTAAACGTACCGGCCC S. frugiperda E2 ubiquitin ligase SF9L0354...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Decrease in the expression of the type 1 PTH/PTHrP receptor (PTH1R) on chondrocytes in animals with osteoarthritis" potx
... at 3, 6, and 12 weeks. After opening the knee joint, OA was macroscopically graded and hyaline cartilage of the load-bearing area was evaluated histologically according to the Mankin scale and ... histological grading of OA. He carried out the quantitative counting of cells and participated in immunohistochemical staining. SO participated in the statistical analysis an...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Substitutions in the Reverse Transcriptase and Protease Genes of HIV-1 Subtype B in Untreated Individuals and Patients Treated With Antiretroviral Drugs" potx
... of the deamination of a cytosine, leading to the inclusion of an adenosine instead of guanosine in positive-stranded cDNA. This results in mutant viruses that contain several G A changes. With ... by increas- ing the intracellular ratio of dCTP/dTTP.[27] An alternative important cause of G A hypermutation may involve a cellular factor, APOBEC3G, a cytidine deaminase that c...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Cancers in the TREAT Asia HIV Observational Database (TAHOD): a retrospective analysis of risk factors" ppt
... South Wales, Sydney, Australia, for co- facilitating the cancer training day and for the development of the TREAT Asia Cancer Training manual. The TREAT Asia Observational Database Collaborators CV ... Ramathi- bodi Hospital at Mahidol University, Bangkok, Thailand, a collaborating site of the Therapeutics Research, Educa- tion and AIDS Training in Asia (TREAT Asia) HIV Obse...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Trends in the clinical characteristics of HIVinfected patients initiating antiretroviral therapy in Kenya, Uganda and Tanzania between 2002 and 2009" pdf
... a cross- sectional analysis of characteristics of HIV-infected adults initiating ART between 2002 and 2009 in Kenya, Uganda and Tanzania and in the International Epidemiologic Databases to Evaluate ... than 5% in 2002 to 65% in Kenya, 53% in Uganda and 44% in Tanzania by 2009 [3]. Access to ART has also had a measureable impact on the eco- nomic and social d...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo khoa học: Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro pot
... [3 0–3 8]. In this study, we analysed several points mutants in the C-terminal domain of ALSV IN and examined their ability to mediate the concerted DNA integration in an in vitro assay as well as ... the formation of this strand as glutamate acts as a strand breaker [61]. Altogether, these data suggest a strong structural role for the terminal part of the C-termin...
Ngày tải lên: 23/03/2014, 15:21