báo cáo hóa học: " Complications and management of acute copper sulphate poisoning; A case discussion" pot

báo cáo hóa học: " Complications and management of acute copper sulphate poisoning; A case discussion" pot

báo cáo hóa học: " Complications and management of acute copper sulphate poisoning; A case discussion" pot

... (chaturaka.rodrigo@gmail.com) Sajitha Weerasinghe (sajithaw@yahoo.com) Ariaranee Gnanathasan (ariaranee2000@yahoo.com) Visvalingam Puvanaraj (vpuvanaraj@yahoo.co.in) Harshani Fernando (harshi.fernando39@gmail.com) ISSN ... 1 Champika SSK Gamakaranage, 2 Chaturaka Rodrigo, 3 Sajitha Weerasinghe, 2 Ariaranee Gnanathasan, 4 Visvalingam Puvanaraj and 3 Harshani Fernando Affiliations:...

Ngày tải lên: 20/06/2014, 00:20

17 340 0
Báo cáo hóa học: " Expression and processing of the Hepatitis E virus ORF1 nonstructural polyprotein" potx

Báo cáo hóa học: " Expression and processing of the Hepatitis E virus ORF1 nonstructural polyprotein" potx

... The primers used for the amplification were EcoRI-ORF1-5', TACGGAATTC ATGGAGGCCCAT- CAGTTTATCAAG and Hind III-ORF1-3', CCAAAGCTT T- GATTTCACCCGACACAAGATTGA, containing the underlined restriction ... oligonu- cleotides AGCTTAACTACAAGGACGACGACGATAAG- TAACTCGAG and TCGACTCGAGTTACTTATCGTCGTCGTCCTTGTAGTC- Virology Journal 2006, 3:38 http://www.virologyj.com/content/3/1/38 Page 5 of...

Ngày tải lên: 20/06/2014, 01:20

9 250 0
Báo cáo hóa học: " Synthesis and Characterization of Monodispersed Copper Colloids in Polar Solvents" pdf

Báo cáo hóa học: " Synthesis and Characterization of Monodispersed Copper Colloids in Polar Solvents" pdf

... semi-dehydroascorbate radical and dehydroascorbic acid (Eq. 1). Therefore, ascorbic acid plays dual roles of reducing agent and antioxidant of copper nanoparticles. The reaction can complete ... 2. Characterization of Copper Nanoparticles XRD measurements were recorded using a (D8-Advance, Germany) X-ray diffractometer equipped with a back mono- chromator operating at 40 kV...

Ngày tải lên: 22/06/2014, 01:20

6 348 0
Báo cáo hóa học: " Melioidosis presenting with mediastinal lymphadenopathy masquerading as malignancy: a case report" pot

Báo cáo hóa học: " Melioidosis presenting with mediastinal lymphadenopathy masquerading as malignancy: a case report" pot

... doi:10.1186/1752-1947-6-28 Kavitha Saravu (kavithasaravu@gmail.com) Chiranjay Mukhopadhyay (chiranjay@yahoo.co.in) Vandana KALWAJE Eshwara (vandanake@gmail.com) Barkur ANANTHAKRISHNA Shastry (shastryba@yahoo.co.in) Kundapura ... Mukhopadhyay 2 , Vandana Kalwaje Eshwara 2 , Barkur Ananthakrishna Shastry 1 , Kundapura Ramamoorthy 1 , Sushma Krishna 3 , Vishwanath Sathyanarayanan 1 1 Depar...

Ngày tải lên: 21/06/2014, 19:20

13 237 1
Báo cáo hóa học: " Non operative management of liver and spleen traumatic injuries: a giant with clay feet" pptx

Báo cáo hóa học: " Non operative management of liver and spleen traumatic injuries: a giant with clay feet" pptx

... grade of BSI and careful selection of candidates for NOM is advisable for a safe conservative management choice. In the most recent years a liberal and more aggressive use of angiography has often ... Selective management of blunt abdominal trauma in children–the triage role of peritoneal lavage. J Trauma 1987, 27(10):1101-6. 8. Pachter HL, Knudson MM, Esrig B, et al: St...

Ngày tải lên: 21/06/2014, 19:20

4 311 0
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx

báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx

... forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5'- TCGTTCCCAATCCCAAGGTA-3'. The rat GAPDH tran- script was measured for each sample to normalize the amount of input RNA ... Express Software (Applied Biosys- tems, Foster City, CA). The ABCG1 probe, FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'...

Ngày tải lên: 18/06/2014, 15:20

15 624 0
báo cáo hóa học:" Isolation and culture of fibroblasts from endoscopic duodenal biopsies of celiac patients" pdf

báo cáo hóa học:" Isolation and culture of fibroblasts from endoscopic duodenal biopsies of celiac patients" pdf

... expressed as mean ± standard deviation (SD) or median and range. A comparison of the morphometric data obtained from culture of CD and non-CD subjects was done using one way ANOVA. All statistical analysis was ... morpho- metric evaluation included the major orthogonal diameters and their ratio, as index of circularity, the perimeter, the area, and their ratio, as index of c...

Ngày tải lên: 18/06/2014, 15:20

8 563 1
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... that identified the candidate biomarkers, and they participated in the data analyses. AAH developed the customized Spotfire tool used for data analyses and reviewed statistical analyses. YG participated ... required upon hand-off for assay validation. SJ, AW, SWA and KA performed the in vitro assays on mon- keys treated with Ab-01 and control Ig and analyzed the data, and KA and...

Ngày tải lên: 18/06/2014, 16:20

13 529 0
Báo cáo hóa học: " Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics" ppt

Báo cáo hóa học: " Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics" ppt

... > T and 74 7A > G variants). Inparticular,CIof18variants including 155 5A > G and 1494C > T mutations were >78%, CI of other 13 variants was between 78% and 50% and CI for the remaining ... structural and phylogenetic analysis. Results: The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years,...

Ngày tải lên: 18/06/2014, 16:20

11 616 0
báo cáo hóa học: " Feasibility and acceptance of electronic quality of life assessment in general practice: an implementation study" pdf

báo cáo hóa học: " Feasibility and acceptance of electronic quality of life assessment in general practice: an implementation study" pdf

... systems of 14 German general practices with varying infrastructure allowed automatic data exchange and the generation of a printout or a PDF file. General practitioners (GPs) and practice assistants ... GPs * as defined according to the qualitative content analysis approach. ** number of GPs and practice assistants (PA); mentions of several categories per participant possibl...

Ngày tải lên: 18/06/2014, 18:20

11 536 0
Từ khóa:
w