báo cáo hóa học: " Acute lead intoxication in a female battery worker: Diagnosis and management" ppt

... differential diagnosis. Moreover, this report indicates that lead remains a significant occupational hazard especially in the small scale battery industry Background Lead is a significant occupational ... 10.1186/1745-6673-5-19 Cite this article as: Dounias et al., Acute lead intoxication in a female battery worker: Diagnosis and management Journal of Occupat...

Ngày tải lên: 20/06/2014, 00:20

... province), Yin- chuan School for the Blind, Deaf and Dumb (Ningxia Province), Xining Spe- cial Education School (Qinghai province), Changan School for the Deaf and Dumb (Shaanxi province), Affiliated ... also ana- lyzed for mutations in Exon1 and flanking introns by PCR/sequencing. The PCR primers used are forward primer: 5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3' and reverse p...

Ngày tải lên: 18/06/2014, 15:20

... original data and revised the manuscript. MDK was involved in data inter- pretation and manuscript revision. HT was involved in study design, data organization, early data interpretation and manuscript ... Murray D Krahn 2,9 and Hla-Hla Thein 10 Address: 1 Section of General Internal Medicine, Lakeridge Health Oshawa, Canada, 2 Faculty of Health Sciences, Queen's Universi...

Ngày tải lên: 18/06/2014, 19:20

... statistical support and early data interpretation, and helped draft and revise the paper. AS conceived the original idea for this paper and revised the manuscript. TB and MHL were involved in ... original survey used in this paper, provided the original data and revised the manuscript. MDK was involved in data inter- pretation and manuscript revision. HT was involved in...

Ngày tải lên: 18/06/2014, 19:20

... the findings. SA and SB carried out the sta- tistical analyses and drafted the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements This study was ... longitudinal study in a gen- eral population with postal surveys at baseline and at an eight-year follow up, and was a part of the Epipain project [22]. Subjects and data collect...

Ngày tải lên: 18/06/2014, 19:20

... mid-shift samples. In these cases, the average USG was taken as the mid-shift value. Eight AVOs had USG data at all time points, and were used in statistical analysis. Data are summarized as mean and ... Standardisation: ISO 9886: Ergonomics - Evaluation of thermal strain by physiological measurements. Geneva: International Organisation for Standardisation; 2004. 25. International Org...

Ngày tải lên: 20/06/2014, 00:20

... using this program information could be gained about main and secondary activities and quantitative information about direct child contact. All activities (main and secondary) were recorded in ... h). Activities in this category mostly involved singing, dancing and other sportive activities as well as preparation and conducting small experiments. Internal communication a...

Ngày tải lên: 20/06/2014, 00:20

... conclude that an ambulating patient with an above knee amputation and a subcapital fracture should be operated on after appropriate planning and preparation with satisfactory results. A patient can return ... studies[4,6] have shown that this an appropriate strategy for most fractures after an amputation, except dis- placed intertrochanteric and cervical fractures that require surgi...

Ngày tải lên: 20/06/2014, 04:20

... Hatanaka Y, Harada M, Higashida Y, Taka- hashi M, Mizutani H, Tashiro H, Iwamasa J, Miyazaki K: Adnexal masses: accuracy of characterization with transvaginal US and precontrast and postcontrast ... ovarian carcinoma A systematic review and meta-analysis. Eur J Radiol 2008:29. 48. Kitajima K, Murakami K, Yamasaki E, Domeki Y, Kaji Y, Fukasawa I, Inaba N, Suganuma N, Sugimura K: Perfor...

Ngày tải lên: 20/06/2014, 07:20

... Kaharuza F, Alexander L, Solberg P, Tappero J, Moore D: Utility of Routine Viral Load, CD4 Cell Count, and Clinical Monitoring among HIV-Infected Adults in Uganda: A Randomized Trial [abstract]. ... antiretroviral therapy for HIV infection in adults and adolescents Geneva: World Health Organization; 2009. 8. Petti CA, Polage CR, Quinn TC, Ronald AR, Sande MA: Laboratory medicine in...

Ngày tải lên: 20/06/2014, 08:20