báo cáo hóa học: " Patterns of pulmonary dysfunction in asbestos workers: a cross-sectional study" docx

... period of time. Therefore, the individual cumulative duration of work in exposed areas was used as surrogate measure of total asbestos exposure. Clinical Evaluation Using a Chinese standardized ... observed small and large airway disease in sheep with tracheal installation of high concentrations of chrysotile asbestos [13]. He further demonstrated that asbestos airway di...

Ngày tải lên: 20/06/2014, 00:20

... at 2.5 atmospheres ab solute (ATA) for a duration of 120 min, using an intermittent schedule of 25 min of oxygen breathing and 5 min of air breathing. Table 1 Schedule of Histomorphological Analysis ... One hole was made in the center of trochlea that articulated with the patella, a weight-bearing surface; the other was made in the nonarticulated notch area, a non-weight...

Ngày tải lên: 20/06/2014, 04:20

... at 2.5 atmospheres ab solute (ATA) for a duration of 120 min, using an intermittent schedule of 25 min of oxygen breathing and 5 min of air breathing. Table 1 Schedule of Histomorphological Analysis ... the trochlear groove of each femur. One hole was made in the center of trochlea that articulated with the patella, a weight-bearing surface; the other was made in the non...

Ngày tải lên: 20/06/2014, 07:20

... Schaar and Turaga [45] developed a joint application-layer adaptive packeti- zation and prioritized scheduling and MAC-layer retransmission strategy, where the application and the MAC layers jointly ... coding based on an analytical model of the overall system. It employs joint source and application-layer chan nel coding and rate adaptation a t the wireless physical layer. • Applicatio...

Ngày tải lên: 21/06/2014, 06:20

... prevalence of participants in each of the latent classes, and the conditional probability of the indicator variables for a participant in a given class, are assessed. Finally, the LCR model also ... Class 2 was character- ized as having physically related poor HRQOL; Class 3 was characterized as having mentally related poor HRQOL; and Class 4 as having both physically and men- t...

Ngày tải lên: 18/06/2014, 19:20

... Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sen- sitivity after an inhaled antigen challenge between actively and passively sensitized guinea pigs. ... significant mitotic activity and without remarkable BRDU incorporation suggests that a metaplasia with subsequent hypertrophy of the glandular apparatus rather than hyperplasia as the u...

Ngày tải lên: 20/06/2014, 00:20

... not separated into stages 4 and 4S since 4S is for infants INSS (International Neuroblastoma Staging System) according to Simpson and Gaze [27] at autopsy Journal of Translational Medicine 2009, ... Stridsberg 3 , Elin Lindhagen 3 and Faranak Azarbayjani 1 Address: 1 Department of Medical Cell Biology, Uppsala University, 75123 Uppsala, Sweden, 2 Department of Woman and Child Heal...

Ngày tải lên: 18/06/2014, 15:20

... Pouchitis and extraintestinal manifestations of inflammatory bowel disease after ileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629. 15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients ... fact that both inflammatory and apoptosis pathways are related. Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway char- acterized by APAF-1 a...

Ngày tải lên: 18/06/2014, 16:20

... Utrophin was taken from Arning et al. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5' acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA level was used as control for normalization ... normalization of samples (For- ward 5#8242; gacaggatgcagaaggagattact 3', Reverse 5#8242; tgatccacatctgctggaaggt 3'). Nothern Blot analysis Given the limited amount of RNA a...

Ngày tải lên: 18/06/2014, 16:20

... contributed substantially to study design, data collection, analysis of data and preparation of the manuscript. All authors have also read and approved the final manuscript. Acknowledgements The authors ... Faculty of Medical Sciences Ethics Commit- tee. Statistical approach All data were initially captured into Epidata ® for Windows and then analyzed with Stata™ statistical software f...

Ngày tải lên: 18/06/2014, 19:20