báo cáo hóa học: " Back disorders and lumbar load in nursing staff in geriatric care: a comparison of home-based care and nursing homes" pptx

... Access Research Back disorders and lumbar load in nursing staff in geriatric care: a comparison of home-based care and nursing homes Kathrin Kromark* 1 , Madeleine Dulon 1 , Barbara-Beate Beck 2 and ... diploma after a three-year training, nursing aides (including assistant nurses) with at least a one-year nursing training without examination,...

Ngày tải lên: 20/06/2014, 00:20

... instance, that the linear dynamics of Σ is subject to variations defined by a small parameter ε, A dc and A dd are time-invariant, and A c t A c for all t ≥ 0andA cd tρεe A c t with ρε ... the sampled state-trajectory solution at sampling instants guarantees the existence of a fixed point of an extended auxiliary discrete system and the existence of a glob...

Ngày tải lên: 21/06/2014, 20:20

... were not statistically significant. The association between hairdressing and smoking and infertility and spontaneous abortion was examined in Norway [33]. The analysis was based on the data from a regional, ... exposure of the subjects was estimated onthebasisoftheweeklyworkingtimeandontheir work posture (standing, walking and standing, changing, sitting). Assistants in clothi...

Ngày tải lên: 20/06/2014, 00:20

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAG CTGC-3' MCP-5: GenBank Accessions # AC012294, NC_000077 5'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3' 5'-CAACTACAG AATCGGCGTGTGCCA-3' 5'-TCACGTG CTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3' Journal ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTG GTACCCT- TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAA...

Ngày tải lên: 19/06/2014, 22:20

... ligands (AEA and 2-AG) and congeners, target receptors, synthesis (NAPE-PLD; DAG lipase), and degradation enzymes (FAAH, MAGL) and proteins involved in their transport, and intracellular trafficking [9]. ... The inhibition of VCAM-1 expression in cerebral vasculature by anandamide pro- vides a new mechanism that may explain the therapeutic action of increased anandamide to...

Ngày tải lên: 19/06/2014, 22:20

... remains a hallmark diagnostic finding in the cerebrospinal fluid (CSF)[1]. While target and pathogenic relevance of this humoral response is still under debate [2], autoantibodies against aquaporin-4 (AQP-4) ... TNF b y ELISA (R&D Systems). Plates were read at 450 nm wavelength by a Tecan Genios plate reader and analyzed using Magellan6 software. Statistical analysis As freque...

Ngày tải lên: 19/06/2014, 22:20

... USA. Authors’ contributions JK and MR carried out the patient selection, analysis of data and drafting of this manuscript. All authors have read and approved the final manuscript. Competing interests MR ... of Labor and Occupational Safety and Health Administration (OSHA) define a musculoske- letal disorder (MSD) as an injury of the muscles, nerves, tendons, ligaments, joi...

Ngày tải lên: 20/06/2014, 00:20

... liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5). Taking all these data into consideration, it appears t hat combina- tion therapy of AdhTERTHRP/IAA ... of infection; ELISA: enzyme-linked immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferase- mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspar...

Ngày tải lên: 20/06/2014, 03:20

... Furthermore, since the estimation quality of the first stage is available, we use BLUE to obtain ˆ θ for exploiting the quality information instead of using the MLE in the M-step as in the standard EM algorithm. During ... physical parameters such as temperature and humidity. Since the sensors are usually powered by batteries and have very limited processing and communication abi...

Ngày tải lên: 20/06/2014, 04:20

... 2004, 286:G1032-1041. 34. Kawakami T, Hoshida Y, Kanai F, Tanaka Y, Tateishi K, Ikenoue T, Obi S, Sato S, Teratani T, Shiina S, et al: Proteomic analysis of sera from hepatocellular carcinoma patients after radiofrequency ... glycosidase assay. KB participated in the data analysis and writing of the manuscript. PA and MG participated in the design of the study, oversaw the colle...

Ngày tải lên: 20/06/2014, 07:20