0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học: " Back disorders and lumbar load in nursing staff in geriatric care: a comparison of home-based care and nursing homes" pptx

báo cáo hóa học:

báo cáo hóa học: " Back disorders and lumbar load in nursing staff in geriatric care: a comparison of home-based care and nursing homes" pptx

... AccessResearch Back disorders and lumbar load in nursing staff in geriatric care: a comparison of home-based care and nursing homesKathrin Kromark*1, Madeleine Dulon1, Barbara-Beate Beck2 and ... diploma after a three-year training, nursing aides (including assistant nurses) with at least a one-year nursing training without examination, and nurs-ing auxiliaries with less or no formal nursing ... the lumbar spine in nursing staff is as high as 76%. Only a fewrepresentative studies have assessed the prevalence rates of back pain and its risk factors among nursing staff in nursing homes in...
  • 9
  • 638
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article Total Stability Properties Based on Fixed Point Theory for a Class of Hybrid Dynamic Systems" pdf

... instance, that the linear dynamics of Σ is subject tovariations defined by a small parameter ε, A dc and A ddare time-invariant, and A ct A cfor all t ≥ 0andAcdtρεe A ctwith ρε ... the sampled state-trajectory solution at sampling instants guarantees the existence of a fixed point of an extended auxiliary discrete system and the existence of a global asymptoticattractor of ... contractive and nonexpansive mappings are investigated in 16 and references there in. 5 The existence of fixed points of Liptchitzian semigroups has been investigated, forinstance, in 13.In...
  • 19
  • 294
  • 0
báo cáo hóa học:

báo cáo hóa học: " Fertility disorders and pregnancy complications in hairdressers - a systematic review" ppt

... werenot statistically significant.The association between hairdressing and smoking and infertility and spontaneous abortion was examined in Norway [33]. The analysis was based on the datafrom a regional, ... exposure of the subjects was estimatedonthebasisoftheweeklyworkingtimeandontheirwork posture (standing, walking and standing, changing,sitting). Assistants in clothing shops were selected as a comparison ... the state of employment of the mother wasavailable. An increased risk of small for gestational age of neonate s was found in the group of all hairdressers,as well as in a subgroup of hairdressers...
  • 13
  • 429
  • 0
báo cáo hóa học:

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3'MCP-5: GenBank Accessions # AC012294, NC_0000775'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3'5'-CAACTACAGAATCGGCGTGTGCCA-3'5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3'Journal ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTGGTACCCT-TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGTGACTCAGAAA AGGACAAGGG GTGAGCCCAACCACAAGGCTGCT-3') was generated by genomic PCRusing a ... 5'-AAGCAGACGTGGTAC-CCACAGTCTTGCTTTAACGCTACTTTTCCAAGATAAGGTGACTCAGAAAAG-GACAAGGGGTGAGCCCAACCACACAGCTGCT-3'3043nt) was PCR-amplified from genomic DNA isolatedfrom FHAs using a pair of primers...
  • 15
  • 541
  • 0
báo cáo hóa học:

báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

... ligands (AEA and 2-AG) and congeners, targetreceptors, synthesis (NAPE-PLD; DAG lipase), and degradation enzymes (FAAH, MAGL) and proteinsinvolved in their transport, and intracellular trafficking[9]. ... The inhibition of VCAM-1expression in cerebral vasculature by anandamide pro-vides a new mechanism that may explain the therapeuticaction of increased anandamide tone in neuroinfl amma-tory ... immunostained for VCAM-1. Arrows indicate VCAM-1immunostaining. Scale bar is 50 μm. (B, D) Quantification of intensity of VCAM-1 staining as described in Material and methods in the ipsilateralor...
  • 13
  • 466
  • 0
báo cáo hóa học:

báo cáo hóa học: " Anti-CD20 B-cell depletion enhances monocyte reactivity in neuroimmunological disorders" docx

... remains a hallmark diagnostic finding in the cerebrospinal fluid (CSF)[1]. While target and pathogenic relevance of this humoral response is stillunder debate [2], autoantibodies against aquaporin-4(AQP-4) ... TNF b y ELISA (R&DSystems). Plates were read at 450 nm wavelength by a Tecan Genios plate reader and analyzed using Magellan6software.Statistical analysisAs frequency of regulatory T-cells ... additional mechanism bywhich anti-CD20 mediates broad clinical benefit in humanautoimmune disease.The main purpose of this translational approach was toinvestigate whether anti-CD20 treatment of...
  • 9
  • 342
  • 0
báo cáo hóa học:

báo cáo hóa học: " Musculoskeletal disorders early diagnosis: A retrospective study in the occupational medicine setting" docx

... USA.Authors’ contributionsJK and MR carried out the patient selection, analysis of data and drafting of this manuscript. All authors have read and approved the final manuscript.Competing interestsMR ... of Labor and Occupational Safety and Health Administration (OSHA) define a musculoske-letal disorder (MSD) as an injury of the muscles, nerves,tendons, ligaments, joints, cartilage and spinal ... away fromwork wit h 27 days [5].Diagnostic Challenges of STIsThe standard approach to managing soft tissue injuriesis to obtain a medical history and perform a physicalexamination. Imaging...
  • 6
  • 398
  • 0
báo cáo hóa học:

báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc

... liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5). Taking allthese data into consideration, it appears t hat combina-tion therapy of AdhTERTHRP/IAA ... of infection; ELISA: enzyme-linkedimmunosorbant assay; TUNEL: terminal deoxynecleotidyl transferase-mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartateaminotransferase; ... the treated animals to measurethe biochemistry markers including alanine transami-nase (ALT), aspartate aminotransferase (AST), b loodurea nitrogen (BUN) and creatine (Cr) using commercialkits...
  • 10
  • 485
  • 0
báo cáo hóa học:

báo cáo hóa học:" Decentralized estimation over orthogonal multiple- access fading channels in wireless sensor networks-- optimal and suboptimal estimators" ppt

... Furthermore, since the estimation quality of the first stage is available, we use BLUE to obtainˆθ for exploiting the quality information instead of using the MLE in the M-step as in the standard EMalgorithm.During ... physical parameters such as temperature and humidity. Since the sensors are usuallypowered by batteries and have very limited processing and communication abilities [1], the parameters areoften ... we regard theMMSE estimator as an unbiased estimate in our suboptimal algorithm and evaluate th e resulting performanceloss via si mulations later.The variance of the M M S E estimate can be...
  • 35
  • 410
  • 0
báo cáo hóa học:

báo cáo hóa học:" Leucine-rich alpha-2-glycoprotein-1 is upregulated in sera and tumors of ovarian cancer patients" pot

... 2004,286:G1032-1041.34. Kawakami T, Hoshida Y, Kanai F, Tanaka Y, Tateishi K, Ikenoue T, Obi S,Sato S, Teratani T, Shiina S, et al: Proteomic analysis of sera fromhepatocellular carcinoma patients after radiofrequency ... glycosidase assay. KB participated in the dataanalysis and writing of the manuscript. PA and MG participated in thedesign of the study, oversaw the collection of patient samples, and editedthe manuscript. ... werewashed and incubated in a 1:50 dilution of fluorescein-labeled secondary antibody (goat polyclonal antibodyagainst mouse heavy and light chains (IgG and IgM),Roche International, Basel,Switzerland)inthedark.Cells...
  • 14
  • 493
  • 0

Xem thêm

Từ khóa: a comparison of reading paper and online documentsbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ