báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf

... Main and second activities Status CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SA Event +CA2 +SA +MA2 + SA2 +CA -SA -MA Result CA1 stop CA → MA MA1 stop SA1 stop MA stop SA stop MA stop CA2 start SA ... SA start MA2 start SA2 start SA stop MA → CA SA stop CA start SA → CA CA start CA = Central Activity (no second activity). MA = M ain Activity. SA = S econd Activity. Journal of Occupational M...

Ngày tải lên: 20/06/2014, 00:20

... citation purposes) Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Uganda Variable Total Undetectable ... Mandalia, Jessica Oyugi, Rose Naluggya, Ali Taylor, Petra Schaefer, David Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance. The st...

Ngày tải lên: 20/06/2014, 08:20

... consensus primers (D1: 5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2: 5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3'). Dengue Nested PCR The nested PCR assay was performed according to the pro- tocol ... forward primer (D1), and four serotype specific reverse primers (Ts1: 5' CGTCTCAGTGATCCG- GGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3: 5' TAACATCATCATGAGAC...

Ngày tải lên: 20/06/2014, 01:20

... possible fea- Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals Ezra Black John Lafferty Salim Roukos <black I j laff ] roukos>*watson, ... of application domain. • Development of a manually-bracketed corpus (tree- bank) of the domain. • Creation of a grammar with a large coverage of a blind t...

Ngày tải lên: 08/03/2014, 07:20

... required upon hand-off for assay validation. SJ, AW, SWA and KA performed the in vitro assays on mon- keys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed the experiments ... that identified the candidate biomarkers, and they participated in the data analyses. AAH developed the customized Spotfire tool used for data analyses and reviewed statisti...

Ngày tải lên: 18/06/2014, 16:20

... writ- ing of the manuscript. JB designed and managed the valu- ation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript. All authors read and approved ... respectively. Table 5 presents examples comparing the predicted values according to each model and the actual values for each health state. Validation of the preference based...

Ngày tải lên: 18/06/2014, 19:20

... analysis of literature. Transplantation 1997, 64:1261-1273. 15. Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S, Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related ... data and performed the statistical analysis BD and VM: participated in the design of the study, collected medical data and participated to the inter- pretation of dat...

Ngày tải lên: 18/06/2014, 19:20

... citation purposes) Health and Quality of Life Outcomes Open Access Research Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index Patricia Kaoulla 1 , ... questionnaire and demographic information A questionnaire relating to the participants' age, medical history and foot pain location was interviewer adminis- te...

Ngày tải lên: 18/06/2014, 22:20

... Canada and 3 Health Care and Epidemiology, University of British Columbia, Canada Email: Wolfgang Linden* - wlinden@psych.ubc.ca; Dahyun Yi - dyi@hotmail.com; Maria Cristina Barroetavena - mbarroet@bccancer.bc.ca; ... citation purposes) work and Support Assessment (SNSA) which taps into available informational, instrumental, and emotional support. One additional item (not part...

Ngày tải lên: 20/06/2014, 15:20

... (10.9%) ETHNICITY: - White/Caucasian 168 (83.2%) - Black/African American 14 (6.9%) - Latino/Hispanic/Mexican American 10 (5.0%) - Native American/Alaskan Native 1 (0.5%) - Asian American/Pacific Islander 5 (2.5%) - ... Sinha A, Hass SL, Colman SS, Kumar RN, Brod M, Rowland CR: Validation of a general measure of treatment satisfaction, the Treatment Satisfaction Questionnaire for Medic...

Ngày tải lên: 18/06/2014, 19:20