báo cáo hóa học: " Effort-reward imbalance and overcommitment in employees in a Norwegian municipality: a cross sectional study" pdf

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot

... conception, design, and acquisition of data, analysis and interpretation of data, writing and approval of the manuscript. Competing interests The author declares that they have no competing interests. Received: ... used instead of VAD. Finally, DAPK methylation and oligoclonal reconstitu- tion as potential adverse and favorable risk factors in mye- loma warrants further validation...

Ngày tải lên: 18/06/2014, 16:20

7 489 0
báo cáo hóa học: " Physical activity and quality of life in community dwelling older adults" pptx

báo cáo hóa học: " Physical activity and quality of life in community dwelling older adults" pptx

... of data, analysis and interpretation of data, have been involved in drafting and revising the manuscripts, and given final approval of the version to be published. Acknowledgements Edward McAuley ... dwelling adults aged 50 and older via flyers and electronic newsletters advertising par- ticipation in a study of physical activity beliefs. A total of 349 individuals expressed...

Ngày tải lên: 18/06/2014, 19:20

7 411 0
Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc

Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc

... samples were treated with 2% uranyl acetate, washed again, and dehydrated in increasing concentrations of acetone (50, 70, 90, and 100%) for 15 min each time at 4°C. Infiltration in resin was ... mRNA in colon, breast and lung cancer tissues detected using quantitative analysis. Cancer Sci 2007, 98:315-320. 40. Nagasaki K, Manabe T, Hanzawa H, Maass N, Tsukada T, Yamaguchi K: Iden...

Ngày tải lên: 20/06/2014, 01:20

20 622 0
báo cáo hóa học:" Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" pdf

báo cáo hóa học:" Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" pdf

... primers. ECD-forward: 5’ AAA CTC GAG ATG GAG CTG GCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTT CGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward: 5’ AAACTCGAGAAGCGACGGCAGCAGAAG AT 3’ and reverse: 5’ CTT AAG CTT TCA CAC TGG CAC ... data analysis, MOI and MMG performed IHC analysis, LG prepared blood samples, M-LA, EW and X-YW participated in drafting the manuscript and data Table 1 Patient...

Ngày tải lên: 20/06/2014, 03:20

5 289 0
báo cáo hóa học:" Medication quality and quality of life in the elderly, a cohort study" doc

báo cáo hóa học:" Medication quality and quality of life in the elderly, a cohort study" doc

... contributions INO participated in the design of the study, the statistical analysis and the drafting of the manuscript. RR participated in the statistical analysis and the drafting of the manuscript. PE participated ... treatment. To prescribe drugs is important in medical treatment and demonstrates initiative and action, but good and appropriate prescribing demand s many cons...

Ngày tải lên: 20/06/2014, 15:20

9 381 0
báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

... below). For information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about ... constant. Most intriguing is the zero-balanced case. For example, (2011) Abramowitz, M, Stegun, IA (eds.): Handbook of Mathematical Functions with Formulas, Graphs 16 References [1] and...

Ngày tải lên: 18/06/2014, 15:20

17 381 0
báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc

báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc

... collected and analyzed data. KST interpreted data and wrote the manuscript. CRS, JL and HH acquired data. FZC analyzed and interpret data. YHA designed the study and approved the manuscript. Additional ... visualization. Statistics analysis Means and standard error of the mean (SEM) were calcu- lated. The one-way analysis of variance (ANOVA) was applied to analyze continuous varia...

Ngày tải lên: 18/06/2014, 15:20

11 1K 0
báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

... α- and β-Catenin to Cadherins, that are involved in the formation and maintenance of the histo-architecture. [19] 103 Plasmonogen activator inhibitor-2 (PAI-2) Involved in the regulation and inhibition ... damage. Nature 1999, 401(6753):616-620. 25. Osada H, Tatematsu Y, Yatabe Y, Nakagawa T, Konishi H, Harano T, Tezel E, Takada M, Takahashi T: Frequent and histological type- spec...

Ngày tải lên: 18/06/2014, 15:20

8 530 0
báo cáo hóa học:" Species distribution and antimicrobial susceptibility of gram-negative aerobic bacteria in hospitalized cancer patients" pdf

báo cáo hóa học:" Species distribution and antimicrobial susceptibility of gram-negative aerobic bacteria in hospitalized cancer patients" pdf

... conception and design, pro- vision of study materials or patients, collection and assembly of data, data analysis and interpretation and manuscript writing. All authors read and approved the final manuscript. Acknowledgements We ... (cipro- floxacin), the newest fluoroquinolones (levofloxacin, gat- ifloxacin) have enhanced activity against gram-positive bacteria with only a minima...

Ngày tải lên: 18/06/2014, 15:20

13 599 0
báo cáo hóa học:" Of gastro and the gold standard: evaluation and policy implications of norovirus test performance for outbreak detection" ppt

báo cáo hóa học:" Of gastro and the gold standard: evaluation and policy implications of norovirus test performance for outbreak detection" ppt

... to define positivity. The RT 2 -PCR assay was evaluated for a year, and trialed in our laboratory for an additional year, before being inte- grated into the laboratory's clinical testing repertoire. ... and 2 (G2) strains. These assays have uti- lized in a variety of geographic settings and in the context of both outbreak investigation and in the evaluation of sporadi...

Ngày tải lên: 18/06/2014, 15:20

9 449 0
w