... internal carotid arteries. After inspec- tion to ascertain adequate pulsation of the common carotid artery, the surgical incision was closed, and the rats were allowed to recover from anaesthesia in ... phenylephrine in an organ chamber, relaxation in response to incremental doses of acetylcholine was assessed (Figure 3). Maximal relaxation of vessel rings from human CD34+ t...
Ngày tải lên: 18/06/2014, 15:20
... Snapshot of a key intermediate in enzymatic thiamin catalysis: Crystal structure of the a- carbanion of (a, b-dihydroxyethyl) -thiamin diphosphate in the active site of transketolase from Saccharomyces ... [29]. These conformational transitions are accompanied by large-scalechangesintherelativeorientationofthedimers in the tetramer. In the three-dimensional structur...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo hóa học: "Hybrid approach of ventricular assist device and autologous bone marrow stem cells implantation in end-stage ischemic heart failure enhances myocardial reperfusion" doc
... and interpretati on. GK Collection and assembly of data. AD Collection and assembly of data. AK Data analysis and interpretation, collection and assembly of data. CP Conception and design, data ... Conception and design, provision of patients, data analysis and interpretation, manuscript writing. PA Conception and design, data analysis and interpretation, manuscript writing. HA Data...
Ngày tải lên: 18/06/2014, 16:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* ... gradient of 0–1 m NaCl. The fractions containing the protein were pooled and precipitated by addition of ammonium sulfate to a concentration of 75%. The precipitated protein was...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... determined using a single flash photolysis experiment. The approach is based on determination of the bimolecular association rate constant of O 2 rebinding and the quantum yield of BR, c. The latter ... take place. By contrast, at pH values of 6.8 and 7.4, addition of NaCl to a concentration of 0.5 m results not only in an increase in the dimer fraction [33], bu...
Ngày tải lên: 16/03/2014, 14:20
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx
... michele.cioffi@unina2.it; Ernesto Nola - ernesto.nola@unina2.it; Carmela Dell'Aversana - carmela.dellaversana@unina2.it; Vincenzo Sica - vincenzo.sica@unina2.it; Anna Maria Molinari - annamaria.molinari@unina2.it; ... might help in the understanding of the adverse effects caused in humans. Abbreviations AKT: RAC-alpha serine/threonine-protein kinase; AML: Acute Myeloid Leuk...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx
... AGA AGT GG CCC TCA GTC AAG CGC TAC AT IL-6 MN_000600.3 ATG CAA TAA CCA CCC CTG AC TAA AGC TGC GCA CAA TGA GA b-actin MN_031144.2 ACC TGA CTG ACT ACC TCA TG GCA GCC GTG GCC ATC TCT TG Takahashi ... cascades, and targets eukaryotic translation initiation factor 4E binding protein 1. Severe inflammatory disease is a critical con- dition linked to collapse of the Th1/Th2 balance and, from...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Doubtful outcome of the validation of the Rome II questionnaire: validation of a symptom based diagnostic tool" doc
... estab- lish the validity of the Swedish translation of the Rome II modular questionnaire. Translation Adequate translation into Swedish was undertaken in sev- eral steps following standard international ... obtaining broad information of the frequency of certain symptoms, and for clustering of symptoms into domains. In clinical prac- tice a questionnaire may help the...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Multinational development of a questionnaire assessing patient satisfaction with anticoagulant treatment: the ''''Perception of Anticoagulant Treatment Questionnaire'''' (PACT-Q©)" docx
... three areas of interest: 'Treatment', &apos ;Disease and Complications' and 'Information about disease and anticoagulant treatment'. After clinician and patient interviews, ... for the inter- national comparison and pooling of data to generate eas- ily interpretable summary scores [40]. The availability of the PACT-Q in 14 language versions makes it i...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Clinical assessment of the physical activity pattern of chronic fatigue syndrome patients: a validation of three methods" pptx
... or 'active'. These topics are: the routine pattern of activities and the amount of time laying or sitting during the day of yesterday, the number of times leaving the house during a day ... formula for the IPAQ predicting the probability that a particular patient is active became: ('walking'= score on subscale 'walking', 'moderate...
Ngày tải lên: 18/06/2014, 19:20