Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot
Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot
... AccessResearch Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional studyMir Saeed Attarchi*1, Omid Aminian2, Mandana Dolati3 and ... of Health & Medical Education, Tehran, IranEmail: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Mandana Dolati - mandanadolati@yahoo.com; Maria Mazaheri ... to VCM [1].VCM is hepatotoxic and carcinogenic and can cause liver damages such as hepatic fibrosis, hepatic angiosarcoma,hepatocellular carcinoma, portal hypertension, etc.The mechanism of...
- 6
- 380
- 0
Báo cáo hóa học: " Evaluation of normalization methods for two-channel microRNA microarrays" ppt
... applied to data obtained by miR microarray analysis of 9renal cancer cell lines.Author details1Division of Cancer Treatment and Diagnosis, National Cancer Institute,National Institutes of Health, ... cell carcinoma cell lines were isolated using T rizolreagent. Small RNA in total RNA samples were enrichedand p urified by flashPAGE Fractionator (Ambion, Aus-tin, TX USA) according to the manufacturer’ ... this article as: Zhao et al.: Evaluation of normalization methods fortwo-channel microRNA microarrays. Journal of Translational Medicine 20108:69.Zhao et al . Journal of Translational Medicine...
- 7
- 513
- 0
Báo cáo hóa học: "Evaluation of six CTLA-4 polymorphisms in highrisk melanoma patients receiving adjuvant interferon therapy in the He13A/98 multicenter trial" docx
... reversebiotinylated-TGCCAATTGATTTATAAAGGACTG,JO 27 forward GAGCTGGTCAGCCGAGAT, reversebiotinylated- TGACACCACCCCTCCAT AAT, JO 30forward CAAA GCAAAACGCTGCCAATAA, reversebiotinylated- TCCAGTGGCAATAGGAGCTTTC, ... ACCCTTGTACTCCAGGAAATTCTC, reversebiotinylated-GGTTTAGCTGTTACGTCGAAAAGA,AG 49 forward TTTCAGCGGCACAAGGCTC, reversebiotinylated-GAGTGCAGGGCCAGGTCC, CT 60 for-ward GCAAGTCATTCTTGGAAGGTATC, reversebiotinylated-TGCCAATTGATTTATAAAGGACTG,JO ... GCTCAGCTGAACCTG, CT 60 TCACCACTATTTGGGATAT, JO 27 TACCAGAAGTTGAAGTGTAG, JO 30 TCTGTCAGCAAAGCC, and JO31 ACCTCTTGAGGTCAGGAGT http://hapmap.ncbi.nlm.nih.gov/index.html.en.Statistical AnalysisAllele frequencies...
- 9
- 516
- 0
Báo cáo hóa học: "Evaluation of the anti-angiogenic properties of the new selective aVb3 integrin antagonist RGDechiHCit" potx
... of the new selective a Vb3integrin antagonistRGDechiHCitGaetano Santulli1, Maria Felicia Basilicata1, Mariarosaria De Simone2, Carmine Del Giudice1, Antonio Anastasio1,Daniela ... proteins containing the RGD triad,many studies have demonstrated that the aminoa cidsflanking the RGD sequence of high-affinity ligandsappear to be critical in modulating their specificity of interaction ... migration and inv asion [26]. To evaluateany potential antiangiogenic activity of our novel integ-rin antagonist, in vitro angiogenesis assays were con-ducted by evaluating hFN-induced angiogenesis...
- 10
- 539
- 0
báo cáo hóa học: "Evaluation of the impact of fibromyalgia on patients'''' sleep and the content validity of two sleep scales" pptx
... to sixtimes a week. Additionally, each of the participantsreported pain in all four quadrants of their body, and theiraverage typical pain level was 6.0 on a 0- to 10-point scale(0 indicating ... cycle of increased pain andpoor sleep; one participant described this cycle as "painleads to a bad night, and a bad night leads to pain the nextday."Table 3: Characteristics of cognitive ... potential modification were identified, such asthe need to separate the item regarding awakening short of breath and awakening with a headacheinto two separate questions. Participants also questioned...
- 7
- 526
- 1
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... impairment [15].The present study examines perceptions of sleep in aninternational clinical trial aimed at evaluating the efficacyand safety of the pregabalin, a treatment for pain relief in patients ... given a daily pain diary at visit 1(V1) and had to record pain during the next 7 days of thebaseline phase. The diary consists of a single item with an11-point numeric self-administered rating ... concepts are transformed line-arly to have scores ranging from 0 to 100, higher scoresindicating better HRQoL.Daily pain and sleep interference diaries were collectedagain at V6. A Clinical Global...
- 12
- 553
- 0
Báo cáo hóa học: " Evaluation of quality of life and description of the sociodemographic state in adolescent and young adult patients with phenylketonuria (PKU)" docx
... socioeconomic dataThe data on marital status, children and habitation areshown in table 5. Data on school and professional educa-tion are summarised in table 6. A great percentage of patients still ... 1:12.000 in Germany. Due to a blockage in its degradation the essential amino acid phenylalanineaccumulates resulting in severe mental retardation andneurological abnormalities. Treatment of PKU ... early-diagnosedand treated PKU patients. Aim of the study was to analyse quality of life and social status, whichare important parameters for an overall estimation of success of treatment apart...
- 7
- 417
- 0
Báo cáo hóa học: " Evaluation of upper extremity robot-assistances in subacute and chronic stroke subjects" doc
... subjects had grasping assistance, 5 hadcatching assistance and 7 had tunnel assistance. Sevenchronic subjects had grasping assistance, 4 had catchingassistance and 5 had tunnel assistance. The ... down a sloped table and place it in a basketabove the table. Our study examines the influence of catching assistance, pick-and-place movement assistance andgrasping assistance on the catching ... of the ball and a p arameter which indicates the task states(the ball is caught, the ball is placed, the ball is missed). Evaluation parameters and data analysisThe positions of the robot and...
- 9
- 704
- 0
báo cáo hóa học: " Evaluation of methods for extraction of the volitional EMG in dynamic hybrid muscle activation" pot
... means of their sampled actual values, obtainedfrom repetitive dynamic contraction data simulating typi-cal gait-like activity of the TA muscle during a swingphase. The advantage of this approach ... subject was asked to maximally and isometricallycontract his right TA muscle for 5 s. A time window of 0.5s from the maximal contraction plateau was taken to cal-culate the mean torque and mean ... Engineering – Technion, Israel Institute of Technology, Haifa, Israel and 2Loewenstein Rehabilitation Center, Raanana, IsraelEmail: Eran Langzam - bmeran@bm.technion.ac.il; Eli Isakov* - elii@clalit.org.il;...
- 11
- 602
- 0
báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx
... Sugita*1, Makoto Yoshizawa2, Makoto Abe1, Akira Tanaka3, Takashi Watanabe2, Shigeru Chiba4, Tomoyuki Yambe5 and Shin-ichi Nitta5Address: 1Graduate School of Engineering, Tohoku ... Akira Tanaka - a- tanaka@sss.fukushima-u.ac.jp; Takashi Watanabe - nabe@yoshizawa.ecei.tohoku.ac.jp; Shigeru Chiba - chiba.shigeru@sharp.co.jp; Tomoyuki Yambe - yambe@idac.tohoku.ac.jp; Shin-ichi ... Seiryo-machi, Aoba-ku, Sendai, 980-8575, JapanEmail: Norihiro Sugita* - sugita@yoshizawa.ecei.tohoku.ac.jp; Makoto Yoshizawa - yoshizawa@ieee.org; Makoto Abe - abe@yoshizawa.ecei.tohoku.ac.jp; Akira...
- 6
- 534
- 0
Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ