Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot
... Access Research Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study Mir Saeed Attarchi* 1 , Omid Aminian 2 , Mandana Dolati 3 and ... of Health & Medical Education, Tehran, Iran Email: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Man...
Ngày tải lên: 20/06/2014, 00:20
... applied to data obtained by miR microarray analysis of 9 renal cancer cell lines. Author details 1 Division of Cancer Treatment and Diagnosis, National Cancer Institute, National Institutes of Health, ... cell carcinoma cell lines were isolated using T rizol reagent. Small RNA in total RNA samples were enriched and p urified by flashPAGE Fractionator (Ambion, Aus- tin, TX USA) accor...
Ngày tải lên: 18/06/2014, 16:20
... reverse biotinylated-TGCCAATTGATTTATAAAGGACTG, JO 27 forward GAGCTGGTCAGCCGAGAT, reverse biotinylated- TGACACCACCCCTCCAT AAT, JO 30 forward CAAA GCAAAACGCTGCCAATAA, reverse biotinylated- TCCAGTGGCAATAGGAGCTTTC, ... ACCCTTGTACTCCAGGAAATTCTC, reverse biotinylated-GGTTTAGCTGTTACGTCGAAAAGA, AG 49 forward TTTCAGCGGCACAAGGCTC, reverse biotinylated-GAGTGCAGGGCCAGGTCC, CT 60 for- ward GCAAGTCATTCTTGG...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "Evaluation of the anti-angiogenic properties of the new selective aVb3 integrin antagonist RGDechiHCit" potx
... of the new selective a V b 3 integrin antagonist RGDechiHCit Gaetano Santulli 1 , Maria Felicia Basilicata 1 , Mariarosaria De Simone 2 , Carmine Del Giudice 1 , Antonio Anastasio 1 , Daniela ... proteins containing the RGD triad, many studies have demonstrated that the aminoa cids flanking the RGD sequence of high-affinity ligands appear to be critical in modulating their specifici...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: "Evaluation of the impact of fibromyalgia on patients'''' sleep and the content validity of two sleep scales" pptx
... to six times a week. Additionally, each of the participants reported pain in all four quadrants of their body, and their average typical pain level was 6.0 on a 0- to 10-point scale (0 indicating ... cycle of increased pain and poor sleep; one participant described this cycle as "pain leads to a bad night, and a bad night leads to pain the next day." Table 3:...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
... impairment [15]. The present study examines perceptions of sleep in an international clinical trial aimed at evaluating the efficacy and safety of the pregabalin, a treatment for pain relief in patients ... given a daily pain diary at visit 1 (V1) and had to record pain during the next 7 days of the baseline phase. The diary consists of a single item with an 11-point numer...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Evaluation of quality of life and description of the sociodemographic state in adolescent and young adult patients with phenylketonuria (PKU)" docx
... socioeconomic data The data on marital status, children and habitation are shown in table 5. Data on school and professional educa- tion are summarised in table 6. A great percentage of patients still ... 1:12.000 in Germany. Due to a blockage in its degradation the essential amino acid phenylalanine accumulates resulting in severe mental retardation and neurological abnorma...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Evaluation of upper extremity robot-assistances in subacute and chronic stroke subjects" doc
... subjects had grasping assistance, 5 had catching assistance and 7 had tunnel assistance. Seven chronic subjects had grasping assistance, 4 had catching assistance and 5 had tunnel assistance. The ... down a sloped table and place it in a basket above the table. Our study examines the influence of catching assistance, pick-and-place movement assistance and grasping assistance on the ca...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Evaluation of methods for extraction of the volitional EMG in dynamic hybrid muscle activation" pot
... means of their sampled actual values, obtained from repetitive dynamic contraction data simulating typi- cal gait-like activity of the TA muscle during a swing phase. The advantage of this approach ... subject was asked to maximally and isometrically contract his right TA muscle for 5 s. A time window of 0.5 s from the maximal contraction plateau was taken to cal- culate the m...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx
... Sugita* 1 , Makoto Yoshizawa 2 , Makoto Abe 1 , Akira Tanaka 3 , Takashi Watanabe 2 , Shigeru Chiba 4 , Tomoyuki Yambe 5 and Shin-ichi Nitta 5 Address: 1 Graduate School of Engineering, Tohoku ... Akira Tanaka - a- tanaka@sss.fukushima-u.ac.jp; Takashi Watanabe - nabe@yoshizawa.ecei.tohoku.ac.jp; Shigeru Chiba - chiba.shigeru@sharp.co.jp; Tomoyuki Yambe - yambe@idac.tohoku.ac.jp; Shin...
Ngày tải lên: 19/06/2014, 10:20