Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx

... Corresponding author Abstract Aims: To analyze the relationship between exposure to chlorinated and aromatic organic solvents and malignant lymphoma in a multi-centre, population-based case-control study. Methods: ... the manuscript and performed the statistical analysis. MM participated in the statistical analysis and in drafting the manuscript. JB participated in...

Ngày tải lên: 20/06/2014, 00:20

... germline and somatic mutations of this gene in VHL patients and sporadic RCC. Today, more than 400 germline mutations have been reported in VHL patients and about 300 somatic mutations in sporadic RCC ... read and approved the manuscript. Acknowledgements The study received funding from the European Chlorinated Solvent Asso- ciation (ECSA) and the Halogenated Solvents Indu...

Ngày tải lên: 20/06/2014, 00:20

... 2 Immunostaining of prostate cancer tissue with antibodies against AMACR and PSA. Surgically resected prostate cancer tissue was immunostained with an anti-AMACR antibody (panel A) or anti-PSA antibody ... granulocyte macrophage colony-stimulat- ing factor (GM-CSF) were kind gifts from Takeda Pharma- ceutical Co. (Osaka, Japan), Ono Pharmaceutical Co. (Osaka, Japan) and Novartis Pharmac...

Ngày tải lên: 18/06/2014, 15:20

... clinical data of patients and performed statistical data analysis. AJ and TK coordinated the study and were involved in drafting the manuscript and revised it critically. All authors read and approved ... the leading causes of cancer-related death. Dysregulation and abnormal activation of the Wnt/b-catenin signalling pathway caused by mutations of APC are decisive for the init...

Ngày tải lên: 18/06/2014, 16:20

... sensor was affixed, participants performed 30 s of 'baseline' activities such as blinking, talking, smiling and moving their head. Scale-specific thresholds were automatically evaluated ... quick and sustained eye-brow raises, eye blinks and head move- ment. JNER JOURNAL OF NEUROENGINEERING AND REHABILITATION Alves and Chau Journal of NeuroEngineering and Rehabilitation...

Ngày tải lên: 19/06/2014, 08:20

... Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications ... relate the papers by Sveistrup and Viau et al. also published on JNER this month. Viau et al. com- pare the kinematic strategies of reach, grasp, and place movements performed with...

Ngày tải lên: 19/06/2014, 10:20

... http:// www.adaptiveinformation.net a multi-disciplinary research cluster that brings together researchers in areas such as wearable computing, sensor technologies, infor- mation retrieval and artificial ... polymers are attractive for sensing in a gar- ment-integrated context because of their ability to retain the tactile and mechanical properties of a textile-based structure....

Ngày tải lên: 19/06/2014, 10:20

... potential roles of C 3a and C 5a anaphylatoxins in neu- roprotection by investigating the effects of C 3a and C 5a in parallel with their peptidic analogs, MAP-C 3a and MAP- C 5a on NGF release by astrocytes. ... contaminants in anaphyla- toxin preparations. Analysis of NGF mRNA expression following anaphyla- toxin stimulation was also studied using rat primary astro- cytes...

Ngày tải lên: 19/06/2014, 22:20

... CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI ... Technology) and Organización Panamericana de la Salud (Health Panamer- ican Organization) grant. The authors thank all the persons that kindly...

Ngày tải lên: 20/06/2014, 04:20

... was involved in the study design, analysis and was involved in critically reviewing the manuscript. FA and MUC participated in the designed the study and participated in the preparation of the protocol and ... questionnaire and protocol, collection of data and writing the manuscript. MU was involved in the overall supervision, preparation of the questionnaire and c...

Ngày tải lên: 20/06/2014, 04:20