Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx

Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx

Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx

... Corresponding author Abstract Aims: To analyze the relationship between exposure to chlorinated and aromatic organic solvents and malignant lymphoma in a multi-centre, population-based case-control study. Methods: ... the manuscript and performed the statistical analysis. MM participated in the statistical analysis and in drafting the manuscript. JB participated in...

Ngày tải lên: 20/06/2014, 00:20

11 456 0
Báo cáo hóa học: " Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma" potx

Báo cáo hóa học: " Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma" potx

... germline and somatic mutations of this gene in VHL patients and sporadic RCC. Today, more than 400 germline mutations have been reported in VHL patients and about 300 somatic mutations in sporadic RCC ... read and approved the manuscript. Acknowledgements The study received funding from the European Chlorinated Solvent Asso- ciation (ECSA) and the Halogenated Solvents Indu...

Ngày tải lên: 20/06/2014, 00:20

7 442 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

... 2 Immunostaining of prostate cancer tissue with antibodies against AMACR and PSA. Surgically resected prostate cancer tissue was immunostained with an anti-AMACR antibody (panel A) or anti-PSA antibody ... granulocyte macrophage colony-stimulat- ing factor (GM-CSF) were kind gifts from Takeda Pharma- ceutical Co. (Osaka, Japan), Ono Pharmaceutical Co. (Osaka, Japan) and Novartis Pharmac...

Ngày tải lên: 18/06/2014, 15:20

11 531 0
Báo cáo hóa học: " LEF-1 and TCF4 expression correlate inversely with survival in colorectal cancer" pptx

Báo cáo hóa học: " LEF-1 and TCF4 expression correlate inversely with survival in colorectal cancer" pptx

... clinical data of patients and performed statistical data analysis. AJ and TK coordinated the study and were involved in drafting the manuscript and revised it critically. All authors read and approved ... the leading causes of cancer-related death. Dysregulation and abnormal activation of the Wnt/b-catenin signalling pathway caused by mutations of APC are decisive for the init...

Ngày tải lên: 18/06/2014, 16:20

8 665 0
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

... sensor was affixed, participants performed 30 s of 'baseline' activities such as blinking, talking, smiling and moving their head. Scale-specific thresholds were automatically evaluated ... quick and sustained eye-brow raises, eye blinks and head move- ment. JNER JOURNAL OF NEUROENGINEERING AND REHABILITATION Alves and Chau Journal of NeuroEngineering and Rehabilitation...

Ngày tải lên: 19/06/2014, 08:20

10 501 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

... Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications ... relate the papers by Sveistrup and Viau et al. also published on JNER this month. Viau et al. com- pare the kinematic strategies of reach, grasp, and place movements performed with...

Ngày tải lên: 19/06/2014, 10:20

2 360 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

... http:// www.adaptiveinformation.net a multi-disciplinary research cluster that brings together researchers in areas such as wearable computing, sensor technologies, infor- mation retrieval and artificial ... polymers are attractive for sensing in a gar- ment-integrated context because of their ability to retain the tactile and mechanical properties of a textile-based structure....

Ngày tải lên: 19/06/2014, 10:20

7 748 0
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

... potential roles of C 3a and C 5a anaphylatoxins in neu- roprotection by investigating the effects of C 3a and C 5a in parallel with their peptidic analogs, MAP-C 3a and MAP- C 5a on NGF release by astrocytes. ... contaminants in anaphyla- toxin preparations. Analysis of NGF mRNA expression following anaphyla- toxin stimulation was also studied using rat primary astro- cytes...

Ngày tải lên: 19/06/2014, 22:20

10 777 0
báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf

báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf

... CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI ... Technology) and Organización Panamericana de la Salud (Health Panamer- ican Organization) grant. The authors thank all the persons that kindly...

Ngày tải lên: 20/06/2014, 04:20

10 359 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

... was involved in the study design, analysis and was involved in critically reviewing the manuscript. FA and MUC participated in the designed the study and participated in the preparation of the protocol and ... questionnaire and protocol, collection of data and writing the manuscript. MU was involved in the overall supervision, preparation of the questionnaire and c...

Ngày tải lên: 20/06/2014, 04:20

5 447 0
w