báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

... th at although the very few CD8 T cells found in control brain are all PD-1 positive, the majority of infiltrating CD8 T cells in MS lesions do not express PD-1. Whether T cell infiltration into ... Pittet et al .: Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis. Journa...

Ngày tải lên: 19/06/2014, 22:20

12 294 0
báo cáo hóa học: " Production of IL-16 correlates with CD4+ Th1 inflammation and phosphorylation of axonal cytoskeleton in multiple sclerosis lesions" pptx

báo cáo hóa học: " Production of IL-16 correlates with CD4+ Th1 inflammation and phosphorylation of axonal cytoskeleton in multiple sclerosis lesions" pptx

... CD4+ Th1 cells, into the CNS is tightly regulated by chemoattractant factors [11]. As opposed to chemokines, which bind to chemokine-specific receptors and do not discriminate between distinct cell ... chains of neurofilament Stat-1: signal transducer and activator of transcription-1 Competing interests The author(s) declare that they have no competing inter- ests. Authors' contribu...

Ngày tải lên: 19/06/2014, 22:20

13 425 0
Báo cáo hóa học: " Human neuronal cell protein responses to Nipah virus infection" docx

Báo cáo hóa học: " Human neuronal cell protein responses to Nipah virus infection" docx

... isolates that is most likely to have been transmitted to humans through direct contact with infected pigs [7]. Throughout the study, adherent SK-N- MC cells were infected with NiV to give an estimated ... activation of the G protein signaling pathways [25]. It is possible that increased expression of the G protein is to compensate for the lost of the G protein function following b...

Ngày tải lên: 20/06/2014, 01:20

9 308 0
Báo cáo hóa học: " Self-Assembled 3D Flower-Like Hierarchical b-Ni(OH)2 Hollow Architectures and their In Situ Thermal " pdf

Báo cáo hóa học: " Self-Assembled 3D Flower-Like Hierarchical b-Ni(OH)2 Hollow Architectures and their In Situ Thermal " pdf

... face- centered cubic structure with phase purity. It is interesting and surprising that the porous nanosheet still exhibits an almost single-crystalline diffraction pattern. Here, heat treatment may ... ð5Þ The powders exhibit thermogravimetric transitions that are likely due to the loss of physical absorbed and structural water. The initial weight loss from 30 to 140 °C is attrib- uted...

Ngày tải lên: 22/06/2014, 01:20

8 365 0
Báo cáo hóa học: " Research Article Strong Convergence Theorems for Common Fixed Points of Multistep Iterations with Errors in Banach Spaces" pdf

Báo cáo hóa học: " Research Article Strong Convergence Theorems for Common Fixed Points of Multistep Iterations with Errors in Banach Spaces" pdf

... of Inequalities and Applications From the above definitions, it follows that asymptotically nonexpansive mapping must be asymptotically nonexpansive in the intermediate sense. Let C be a nonempty ... nonexpansive mappings in the intermediate sense. Remark 3.6. If m  3andT 1  T 2  T 3  T in Theorem 3.4, we obtain strong convergence theorem for Noor iteration scheme with error fo...

Ngày tải lên: 22/06/2014, 02:20

12 206 0
Báo cáo hóa học: " Research Article Strong Convergence of a Modified Iterative Algorithm for Mixed-Equilibrium Problems in Hilbert Spaces" pdf

Báo cáo hóa học: " Research Article Strong Convergence of a Modified Iterative Algorithm for Mixed-Equilibrium Problems in Hilbert Spaces" pdf

... the fixed-point set of T i ,thatis,F T i  : {x ∈ C : T i x  x}.Findingan optimal point in the intersection ∩ N i1 F T i  of the fixed-point sets of a family of nonexpansive mappings is a task ... sequentially continuous from the weak topology to the weak topology; ii K : C → R is η-strongly convex with constant μ>0 and its derivative K  is sequentially continuous from the w...

Ngày tải lên: 22/06/2014, 03:20

23 284 0
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

... 196 59 KDR CCTCTACTCCAGTAAACCTGATTGGG TGTTCCCAGCATTTCACACTATGG 219 59 CD34 AAATCCTCTTCCTCTGAGGCTGGA AAGAGGCAGCTGGTGATAAGGGTT 216 59 CD31 ATCATTTCTAGCGCATGGCCTGGT ATTTGTGGAGGGCGAGGTCATAGA 159 59 SCL ... GGTCTCAAGTCAGTGTACAGGTAAGC 129 59 T TGTCCCAGGTGGCTTACAGATGAA GGTGTGCCAAAGTTGCCAATACAC 144 59 FOXA2 CCATTGCTGTTGTTGCAGGGAAGT CACCGTGTCAAGATTGGGAATGCT 196 59 NeuroD CCCATGGTGGGTTGTCATATATTCATGT...

Ngày tải lên: 18/06/2014, 15:20

10 409 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... addition, the potential for hFTs cells to differentiate into skeletal muscle cells was investigated after 40 days of culture in induction medium. The myo- genic differentiation was demonstrated ... vitro. Background Adult mesenchymal stem cells (MSCs) are typically defined as undifferentiated multipotent cells endowed with the capacity for self-renewal and the potential to dif-...

Ngày tải lên: 18/06/2014, 15:20

10 456 0
báo cáo hóa học:" Human T cells express CD25 and Foxp3 upon activation and exhibit effector/memory phenotypes without any regulatory/suppressor function" ppt

báo cáo hóa học:" Human T cells express CD25 and Foxp3 upon activation and exhibit effector/memory phenotypes without any regulatory/suppressor function" ppt

... Foxp3. These results are consistent with our observation in Fig. 1 showing that expression of Foxp3 in CD4+ T cells is more stable than that in CD8+ T cells 6-8 days following T cell activation. In ... These results suggest that activation-induced expression of Foxp3 in CD4+CD25+ T cells is more stable than that in CD8+ CD25+ T cells. Absolute number of T...

Ngày tải lên: 18/06/2014, 15:20

7 404 0
báo cáo hóa học: " Human oligodendroglial cells express low levels of C1 inhibitor and membrane cofactor protein mRNAs" pptx

báo cáo hóa học: " Human oligodendroglial cells express low levels of C1 inhibitor and membrane cofactor protein mRNAs" pptx

... digestion products (bp) C1 inh-F GTT GGG GGA TGC TTT GGT AGA TTT C 332 M13690 Sau 3AI (246, 86) C1 inh-R TTA GGA CTC TGG GGC TGC TGC TGT A (2 introns) CD59-F CTG CTG CTC GTC CTG GCT GTC TTC T 280 ... experimental studies, and for writing the manuscript. AK contributed to the cell culture and the editing of the manuscript. PLM contributed to the conception, interpretation of results and...

Ngày tải lên: 19/06/2014, 22:20

9 280 0
Từ khóa:
w