báo cáo hóa học: " Lipopolysaccharide modulates astrocytic S100B secretion: a study in cerebrospinal fluid and astrocyte cultures from rats" pdf

... S100B secretion: a study in cerebrospinal fluid and astrocyte cultures from rats Maria Cristina Guerra † , Lucas S Tortorelli † , Fabiana Galland, Carollina Da Ré, Elisa Negri, Douglas S Engelke, Letícia Rodrigues, ... this article as: Guerra et al.: Lipopolysaccharide modulates astrocytic S100B secretion: a study in cerebrospinal fluid and astrocy...

Ngày tải lên: 19/06/2014, 22:20

... Polanska †3 , Katarzyna Behrendt 1 , Elzbieta Nowicka 1 , Anna Walaszczyk 1 , Aleksandra Chmura 1 , Regina Deja 1 , Maciej Stobiecki 2 , Andrzej Polanski 3,4 , Rafal Tarnawski 1 and Piotr Widlak* 1 Address: ... awalaszczyk@io.gliwice.pl; Aleksandra Chmura - bialka@io.gliwice.pl; Regina Deja - markery@io.gliwice.pl; Maciej Stobiecki - mackis@ibch.poznan.pl; Andrzej Polanski - andrzej.po...

Ngày tải lên: 18/06/2014, 15:20

... other inflammatory mediators such as prostaglandins [33]; prostaglandins would induce the release of gluta- mate from astrocytes [21,36] leading to increased levels of extracellular glutamate and ... oxide and initiate a cascade of reactive oxygen intermediates [34,35]. Prostaglandins and various cytokines may also indirectly elevate the extracellular con- centration of glutamate by...

Ngày tải lên: 19/06/2014, 22:20

... (NMO), a severe inflammatory demyelinating disorder, has gained increasing interest since the discovery of serum NMO-IgG autoantibodies targeting the aquaporin-4 (AQP4) water channel protein [1, ... Neuropediatrics 2007, 38(5):257-260. 41. Kinoshita M, Nakatsuji Y, Moriya M, Okuno T, Kumanogoh A, Nakano M, Takahashi T, Fujihara K, Tanaka K, Sakoda S: Astrocytic necrosis is induced...

Ngày tải lên: 19/06/2014, 22:20

... of alcohol-containing mouthwashes and oral rinses. SOFW J 2008, 134:70-78. 188. Salaspuro V, Hietala J, Kaihovaara P, Pihlajarinne L, Marvola M, Salaspuro M: Removal of acetaldehyde from saliva ... organisms and mammalian cells, including human cells, and that the data from studies in animals suggest that ethanol causes DNA damage in target tissues [10]. Mechanistic evidence esp...

Ngày tải lên: 20/06/2014, 00:20

... CTGTAGGCCCATAACCAGGA-3’); Actin Forward (5’-CTGTGGCATCCACGAAACTA-3’ )and Reverse (5’- ACATCTGCTGGAAGGTGGAC -3’). The PCR amplifications were carried out in a 25 μl reaction volume containing ... com- pares ALDH1 expression and enzyme activity in normal ovary and serous ovarian tumors in one study. ALDH1 was localized in surface epithelial cells and stroma in the cortical...

Ngày tải lên: 20/06/2014, 07:20

... Lithuania, Hungary, Malta, Poland, Slovenia, Slovakia, Bulgaria and Romania) has somewhat contributed in reshaping the measures specifically addres- sing pastoral areas. In particular, Romania and ... the classification of Less-Favoured Areas, natural handicap payments in mountain areas and in other areas with handicaps contribute, through continued use of agricultural land, to...

Ngày tải lên: 20/06/2014, 22:20

... 2 Journal of Inequalities and Applications of Banach spaces as found in 7, 8. Similar statements related to functionals in finite- dimensional spaces and countable dimensional spaces have been ... the study of convex functions in seminormed space and seminormed algebras. Recently some works have been done by Altin et al. 1, 2,Tripathyetal.1–6, Tripathy and Sarma 3, 4, C...

Ngày tải lên: 21/06/2014, 07:20

... Curtain and H. Zwart, An Introduction to In nite-Dimensional Linear Systems Theory,vol.21ofTexts in Applied Mathematics, Springer, New York, NY, USA, 1995. Hindawi Publishing Corporation Boundary ... Bourdon, and W. Ramey, Harmonic Function Theory, vol. 137 of Graduate Texts in Mathematics, Springer, New York, NY, USA, 1992. 3 R. F. Curtain and A. J. Pritchard, In nite Dimensio...

Ngày tải lên: 21/06/2014, 20:20

... and Applications 20 T. Ibaraki, Y. Kimura, and W. Takahashi, “Convergence theorems for generalized projections and maximal monotone operators in Banach spaces,” Abstract and Applied Analysis, ... nonexpansive mappings and its applications,” Journal of the Korean Mathematical Society, vol. 38, no. 6, pp. 1275–1284, 2001. 31 K. Aoyama, Y. Kimura, W. Takahashi, and M. Toyoda, “...

Ngày tải lên: 21/06/2014, 20:20