báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...

Ngày tải lên: 19/06/2014, 22:20

... the actual value of the bootstrap constant initially decreases, likely to counter the accompanying sharp increase in the standard deviation bands. In other words, as the standard deviation bands widen, ... demonstrated that typical location and spread estimators used in quantitative gait data anal- ysis, i.e. mean and variance, are highly susceptible to small quantities of...

Ngày tải lên: 19/06/2014, 10:20

... clamp contained a rotary encoder, and the telescoping shaft contained a linear encoder, allowing the trailing wheelchair to track the distance and orienta- tion of the lead wheelchair. The connection ... built -in A/ D and D /A boards and a rigid mechanical linkage for connecting the lead wheel- chair to the trailing wheelchair. The computer uses the WindowsXP o...

Ngày tải lên: 19/06/2014, 10:20

... in aged brain in the absence of other pathological features and without a clinical history of parkinsonism or dementia [8]. Attempts have been made to link the clinical progression of PD to the ... drug interactions and spe- cific clinical correlates are needed. List of abbreviations AAD, age at death; AAO, age at onset; AD, Alzheimer's dis- ease; A- R, akinetic-rigid; a...

Ngày tải lên: 19/06/2014, 22:20

... protein, is an anaphylatoxin, increasing vascular permeability. Though C 3a is generally considered to be pro-inflammatory [27-29] because it attracts and activates eosinophils, basophils, and mast cells, ... mast cells, few of these cells are present in the brain. C 3a may, in fact, limit brain inflammation, by decreasing the pro- duction of inflammatory cytokines and inducing t...

Ngày tải lên: 19/06/2014, 22:20

... indicates that the human-adapted SARS virus has crossed into another species. Sequence and epidemiological analyses revealed that a SARS-CoV isolated from a pig was derived from a human strain. ... reading frame 8 (Orf 8) [18]. Identical deletions in Orf 8 have also been seen in animal coronaviruses supporting the idea that SARS-CoV was introduced to humans via an animal inter...

Ngày tải lên: 20/06/2014, 04:20

... Heterosigma akashivo infecting virus (HaV01). The same laboratory is also finishing the sequencing of the 145 kb-genome of T4-like looking cyanophage Ma- LMM01, infecting the toxic cyanobacterium ... their exhaustive analysis [7] of the Sargasso Sea environmental data set [8]. The 4th Algal Virus Workshop made it clear that these giant algal viruses are now entering the genomic...

Ngày tải lên: 20/06/2014, 04:20

... any presently characterized species exist in abundance in the Sargasso Sea. Their isolation and genome sequencing could prove invaluable in understanding the origin and diversity of large DNA ... sequencing of the Sargasso Sea. Science 2004, 304:66-74. 8. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, et al.: Gapped BLAST and PSI-BLAST: a new generation of protein databa...

Ngày tải lên: 20/06/2014, 04:20

... contributions EF drafted the manuscript and participated in the design, data collection, and data analysis. KB helped draft the manuscript and participated in the design and data analy- sis and interpretation ... and design and interpretation of the findings. DC reviewed the manuscript and participated in the study design, analysis and interpretation of findings. All autho...

Ngày tải lên: 20/06/2014, 15:20