báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx

... this article as: Lan et al.: Methyl salicylate 2-O-b- D -lactoside, a novel salicylic acid analogue, acts as an anti-inflammatory agent on microglia and astrocytes. Journal of Neuroinfla mmation ... expression. Neuroinflammation, represented by activated microglia and astrocytes, is a prominent pathological feature that contributestoneurodegenerationinAD.InA...

Ngày tải lên: 19/06/2014, 22:20

... sequences NS AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA NS/5'6U AGCAGU AGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA NS/1 6A( 5U) AGCAGGAGCAAGGGGA UUUUU AACUUUGGAAUAACAACUUAAAACAAUUA NS/1 6A( 6U) ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) NP AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUU...

Ngày tải lên: 20/06/2014, 01:20

... Molecular Basis of Cancer. Philadelphia, PA: WB Saunders Company; 1995. 147. Kawano M, Hirano T, Matsuda T, Taga T, Horii Y, Iwato K, Asaoku H, Tang B, Tanabe O, Tanaka H, et al.: Autocrine generation ... showed data that in teenagers and young adults, 29% possessed lytic antibodies against HHV-8, but only 5% had latent antibodies [191]. 6 .A. g. Asia – Southeast and Asia proper Blood do...

Ngày tải lên: 20/06/2014, 04:20

... have contributed to the data collection/interpretation, mechanical testing and drafting/revising of the manuscript. DW and KB have contributed to the mechanical testing and mechanical evaluation ... Predisposing Factors to Nonunion. Foot and Ankle International 1994, 15:581-84. 3. MacDonald JH, Agarwal S, Lorei MP, Johanson NA, Freiberg AA: Knee Arthrodesis. Journal of American Academ...

Ngày tải lên: 20/06/2014, 04:20

... have contributed to the data collection/interpretation, mechanical testing and drafting/revising of the manuscript. DW and KB have contributed to the mechanical testing and mechanical evaluation ... Predisposing Factors to Nonunion. Foot and Ankle International 1994, 15:581-84. 3. MacDonald JH, Agarwal S, Lorei MP, Johanson NA, Freiberg AA: Knee Arthrodesis. Journal of American Academ...

Ngày tải lên: 20/06/2014, 07:20

... 2007. [12]P.Pahalawatta,R.Berry,T.Pappas,andA.Katsaggelos, “Content-aware resource allocation and packet scheduling for video transmission over wireless networks,” IEEE Journal on Selected Areas in ... the nature of the signal transmission and legal restrictions, the wireless links are not reliable with increased bit error rate, the communication range varies and a ects the transmiss...

Ngày tải lên: 21/06/2014, 05:20

... 14:2579-2587. 93. Sardana G, Jung K, Stephan C, Diamandis EP: Proteomic Analysis of Conditioned Media from the PC3, LNCaP, and 22Rv1 Prostate Cancer Cell Lines: Discovery and Validation of Can- didate Prostate ... discovery. Applications of cancer secretome analysis Identification of cancer biomarkers The major application of cancer secretome analysis is to search for cancer biomarkers....

Ngày tải lên: 18/06/2014, 15:20

... following day, mem- branes were incubated for one hour at room temperature with peroxidase-conjugated anti-mouse and anti-rabbit IgG secondary antibodies (GE Healthcare, Piscataway, NJ) as recommended ... chondro- genic analysis and pictures; Dr. Célia Koiffmann and Cláudia I. E. de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Journal of Transla...

Ngày tải lên: 18/06/2014, 15:20

... research, analyzed data and wrote the paper. JEH performed research, ana- lyzed data, and wrote the paper. SJ performed research, analyzed data and wrote the paper. SGL performed research, analyzed data ... Gibco, Grand Island, NY) and cryopreserved at -160°C in human AB+ serum and basal Iscove's medium (Gibco, Grand Island, NY) containing 10% DMSO (Sigma, St. Louis, MO). This...

Ngày tải lên: 18/06/2014, 15:20

... Elnemr A, Yonemura Y, Bandou E, Kinoshita K, Kawamura T, Takahashi S, Tochiori S, Endou Y, Sasaki T: Expression of collagenase-3 (matrix metalloproteinase-13) in human gastric cancer. Gastric Cancer ... Germany). RNA binds, and all contaminants were washed away efficiently. Pure, concen trated RNA was eluted in water and stored at -70°C until further analy- sis. The amount of total RNA w...

Ngày tải lên: 18/06/2014, 16:20