báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

Báo cáo khoa học: RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients pot

Báo cáo khoa học: RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients pot

... Harris et al. RCAN1 in Alzheimer’s disease FEBS Journal 274 (2007) 1715–1724 ª 2007 The Authors Journal compilation ª 2007 FEBS 1719 RCAN1-1L is overexpressed in neurons of Alzheimer’s disease patients Cathryn ... especially interesting organ in which to examine RCAN1 expression, because calcineurin is highly expressed in this organ, comprising approxi- mately 1%...
Ngày tải lên : 16/03/2014, 11:20
  • 10
  • 302
  • 0
báo cáo hóa học:" CRP identifies homeostatic immune oscillations in cancer patients: a potential treatment targeting tool?" pdf

báo cáo hóa học:" CRP identifies homeostatic immune oscillations in cancer patients: a potential treatment targeting tool?" pdf

... best be explained by bal- CRP cycle in a patient with advanced melanomaFigure 2 CRP cycle in a patient with advanced melanoma. A patient with advanced melanoma showing a similar L -CRP cycle to ... 1; CRP level vs days (Mayo, Rochester). From the serial CRP data-points a 'standard CRP curve' was mathematically derived. CRP cycle in a patient with adva...
Ngày tải lên : 18/06/2014, 15:20
  • 8
  • 376
  • 0
báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

... (pooled peripheral blood samples from healthy donors). Survivin gene levels measured in the peripheral blood of 70 patients with TNM stage I to IV gastric cancerFigure 2 Survivin gene levels measured ... transcriptional levels of Sur- vivin measured in the peripheral blood of patients with gastric carcinoma independently correlate with t...
Ngày tải lên : 18/06/2014, 15:20
  • 8
  • 565
  • 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

... citation purposes) Health and Quality of Life Outcomes Open Access Research Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement ... testing as part of the PROMIS Pediatric Item Bank development process. Abbreviations (PROMIS): Patient Reported Outcomes Measurement Info...
Ngày tải lên : 18/06/2014, 19:20
  • 10
  • 480
  • 1
báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

... 8:96 http://www.jneuroinflammation.com/content/8/1/96 Page 2 of 9 RESEARCH Open Access CRP gene variation affects early development of Alzheimer’s disease-related plaques Eloise Helena Kok 1* , Mervi ... variation affects early development of Alzheimer’s disease-related plaques. Journal of Neuroinflammation 2011 8:96. Submit your next manuscript to BioMed C...
Ngày tải lên : 19/06/2014, 22:20
  • 9
  • 290
  • 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...
Ngày tải lên : 19/06/2014, 22:20
  • 8
  • 447
  • 0
Báo cáo hóa học: " Generalized Models for high-throughput analysis of uncer- tain nonlinear systems" pdf

Báo cáo hóa học: " Generalized Models for high-throughput analysis of uncer- tain nonlinear systems" pdf

... different levels of modeling. ,2 1 Generalized Models for high-throughput analysis of uncer- tain nonlinear systems Thilo Gross , Stefan Siegmund ∗ 2 1 Max-Planck Institute for the Physics of Complex ... — Describe a high-throughput method for the analysis of uncertain models, e.g. in biological research. Methods — Generalized modeling for conceptual anal...
Ngày tải lên : 20/06/2014, 01:20
  • 4
  • 280
  • 0
Báo cáo hóa học: " Altered gene expression in asymptomatic SHIV-infected rhesus macaques (Macacca mulatta)" pdf

Báo cáo hóa học: " Altered gene expression in asymptomatic SHIV-infected rhesus macaques (Macacca mulatta)" pdf

... bind- ing. Interestingly, five actin-binding genes appeared in the list; namely: anillin (ANLN, ID: R16712 ), destrin (DSTN, ID: AA424824 ), utrophin (UTRN, ID: AA676840), cyclin- dependent kinase ... hybridization The gene library for the present project was commercially obtained from Research Genetics (Invitrogen, CA), con- taining 7489 genes, including 7019 known genes, 249 unknown ge...
Ngày tải lên : 20/06/2014, 01:20
  • 8
  • 260
  • 0
Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

... TGAACCGCCAGTTATAACTCAACACAATTATAATAATATTACTTTAAATACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTATTACTAATGTAACCGACTCAGCTGT H120 1239 M41 1321 G Egypt/F/03 1359 TAGTTATAATTATCTAGCAGACGCAGGTTTGGCTATTTTAGATACATCTGGTTCCATAGACATCTTTGTTGTACAAGGTGAATATGGTCTTAATTATTATAAGGTTAATCCTTGCGAAGA H120 ... ATGTTGGTAACACCTCTTTTACTAGTGACTCTTTTGTG H120 1 M41 1 ACGCCAGTTGTTAATTTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATT...
Ngày tải lên : 20/06/2014, 01:20
  • 9
  • 262
  • 0
báo cáo hóa học:" SERCA2a gene transfer improves electrocardiographic performance in aged mdx mice" docx

báo cáo hóa học:" SERCA2a gene transfer improves electrocardiographic performance in aged mdx mice" docx

... Medicine 2011, 9:132 http://www.translational-medicine.com/content/9/1/132 Page 6 of 7 RESEA R C H Open Access SERCA2a gene transfer improves electrocardiographic performance in aged mdx mice Jin-Hong ... AAV SERCA2a vector genome in the mdx heart. Pos. Ctrl., the SERCA2a cis plasmid; Uninf., from an uninfected mdx heart; #1 to #5, from five AAV-9 SERCA2a vector...
Ngày tải lên : 20/06/2014, 04:20
  • 7
  • 307
  • 0
báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

... not for citation purposes) Virology Journal Open Access Research Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, ... infected cells. Human cell lines were infected with Cytomegalovirus, Human Herpesvirus-6, Camelpox virus, SARS coronavirus or Yellow fever...
Ngày tải lên : 20/06/2014, 04:20
  • 5
  • 539
  • 0
báo cáo hóa học:" Age Related Incidence and Early Outcomes of Hip Fractures: A Prospective Cohort Study of 1177 patients" potx

báo cáo hóa học:" Age Related Incidence and Early Outcomes of Hip Fractures: A Prospective Cohort Study of 1177 patients" potx

... 6:5 http://www.josr-online.com/content/6/1/5 Page 3 of 5 RESEARCH ARTICLE Open Access Age Related Incidence and Early Outcomes of Hip Fractures: A Prospective Cohort Study of 1177 patients Anand Pillai 2 , Vivek Eranki 2* , Ravikiran ... the age of the patient. The aim of this study was to assess the affec t of ag e on the incidence, fracture pattern...
Ngày tải lên : 20/06/2014, 04:20
  • 5
  • 298
  • 0
Báo cáo hóa học: " Differential Gene Expression to Investigate the Effects of Low-level Electrochemical Currents on Bacillus subtilis" doc

Báo cáo hóa học: " Differential Gene Expression to Investigate the Effects of Low-level Electrochemical Currents on Bacillus subtilis" doc

... possible that the presence of the biofilm matrix could reduce the effects of current-generated ions. The majority of the planktonic cells are not likely to be in direct contact with the electrode ... µA/cm 2 DC. The genes are listed in the order of gene names. The experiment was done in duplicate and the average expression ratios of the two runs ar...
Ngày tải lên : 20/06/2014, 23:20
  • 47
  • 419
  • 1
Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" pdf

Báo cáo hóa học: " In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics" pdf

... borohydride and antibiotics were used to reduce H[AuCl 4 ]. The seeding of Gnps was done in presence of the antibiotics (Ampi- cillin, Streptomycin and Kanamycin, Fig. 1) individually and thus Gnps conjugated ... Published online: 17 November 2007 Ó to the authors 2007 Abstract Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kana...
Ngày tải lên : 22/06/2014, 19:20
  • 9
  • 285
  • 0
Báo cáo hóa học: " Research Article Variation in the Correlation of G + C Composition with Synonymous Codon Usage Bias among Bacteria" docx

Báo cáo hóa học: " Research Article Variation in the Correlation of G + C Composition with Synonymous Codon Usage Bias among Bacteria" docx

... Adenine T: Thymine G: Guanine C: Cytosine GC1: G + C content at the first codon p osition GC2: G + C content at the second codon position GC3: G + C content at the third codon position H GC1 :EntropyofGC1 H GC2 :EntropyofGC2 H GC3 :EntropyofGC3 E w : ... neither GC1, nor GC2 nor GC3 contributed to synonymous codon usage bias. To compare the contr...
Ngày tải lên : 22/06/2014, 19:20
  • 7
  • 351
  • 0